Skip to content

Evaluation of CCR6 Gene Expression and Circulating CCL20 Levels as Potential Biomarkers in Rheumatoid Arthritis

Evaluation of CCR6 Gene Expression and Circulating CCL20 Levels as Potential Biomarkers in Rheumatoid Arthritis

Status
Not yet recruiting
Phases
Unknown
Study type
Observational
Source
ClinicalTrials.gov
Registry ID
NCT07397741
Enrollment
60
Registered
2026-02-09
Start date
2026-03-01
Completion date
2027-03-01
Last updated
2026-02-09

For informational purposes only — not medical advice. Sourced from public registries and may not reflect the latest updates. Terms

Conditions

Rhematoid Arthritis

Keywords

CCR6/CCL20 axis in Rheumatoid arthritis

Brief summary

Rheumatoid arthritis (RA) is characterized as a systemic auto immune disorder linked to a persistent inflammatory process that can harm both joints and extra articular organs. The upregulation of the CCR6/CCL20 axis in the synovial tissues and salivary glands (in cases of secondary Sjögren's syndrome) is considered to contribute to the recruitment of Th17 cells, which in turn enhances IL 17A production and promotes the inflammatory cycle.

Detailed description

Although the aetiology and progression of RA remain incompletely elucidated, various therapeutic modalities are accessible, significantly altering the prognosis of patients with the disease. Various cell types are implicated in the pathophysiology of RA, including synovial fibroblasts, osteoclasts, immune associated T and B lymphocytes, and macrophages. The orchestration of these cells induces the release of diverse inflammatory mediators (cytokines and chemokines) that perpetuate the chronic inflammatory response of the disease. Chemokines and their receptors regulate lymphocyte recruitment to inflamed joints in RA. Cytokines, encompassing both pro inflammatory and anti-inflammatory types, are recognized for their essential involvement in the evolution of RA via inflammation and the degradation of articular cartilage. The chemokine receptor (CCR)6 is a class A GPCR within the chemokine family, noted for its notable therapeutic promise in immunological research. The sole chemokine ligand for CCR6 is chemokine ligand 20 (CCL20), which is also referred to as macrophage inflammatory protein (MIP) 3α, Exodus 1 and liver and activation regulated chemokine. In humans, it is expressed by neutrophils, Th17 cells and peripheral blood mononuclear cells. This axis has distinct functions in immunological homeostasis and activation. CCL20 is one of the chemokines mainly produced by inflamed synovial cells in response to cytokines, including TNF-α (tumour necrosis factor-α), IL-1, IL-17, and IL-18. Synovial T lymphocytes generate cytokines, such as TNFα, IFNγ and IL 17A. The production of pro inflammatory cytokines was originally ascribed to Th1 cells Subsequently, it was elucidated that IL 17A production among Th cells was confined to a distinct Th cell subpopulation, subsequently designated as Th17. The interaction between CCR6 and CCL20 is critical, not only for the migration of Th17 cells, but also for their activation and differentiation. CCL20 has been shown to be involved in the differentiation of naive T cells into Th17 cells, thereby directly influencing IL 17A production in patients with RA.

Interventions

GENETICGene expression by quantitative Real Time PCR

Sample collection: * 5 ml peripheral blood will be collected under sterile conditions. 1-Gene Expression Assay * Total RNA Extraction * cDNA Synthesis * Gene Expression Analysis: o Quantitative Real-Time PCR (qRT-PCR) for CCR6 gene expression using primer as follows: Forward primer (5'-3'): CCACAATGAGCGGGGAATCAATGAA Reverse primer (5'-3'): CAAATAGCCTGGAGAACTGCCTGAC * Normalization using housekeeping gene (GAPDH) Forward primer (5'-3'): GAAACCTGCCAAGTATGATG Reverse primer (5'-3'): AGGAAATGAGCTTGACAAAG 2-Assesment of CCL20 plasma level * Using Enzyme Linked Immunosorbent Assay kit (ELISA).

Sponsors

Sohag University
Lead SponsorOTHER

Study design

Observational model
CASE_CONTROL
Time perspective
CROSS_SECTIONAL

Eligibility

Sex/Gender
ALL
Age
18 Years to 60 Years
Healthy volunteers
Yes

Inclusion criteria

* Adults (18-60 years) diagnosed with RA according to the American College of Rheumatology/European League Against Rheumatism (ACR/EULAR) 2010 classification criteria for RA by an expert rheumatologist.

Exclusion criteria

* • Patients with co-existing infections or other autoimmune diseases.

Design outcomes

Primary

MeasureTime frameDescription
assess expression of CCR6 gene in peripheral blood leukocytes of RA patients compared to healthy individualswithin 3 days of samples collectionassessment of CCR6 gene expression level using quantitative real time PCR

Secondary

MeasureTime frameDescription
Measure the plasma levels of CCL20within 3 days after samples collectionMeasurement of the plasma levels of CCL20 using enzyme-linked immunosorbent assay (ELISA)

Contacts

CONTACTSalma Khalaf Abdelmageed, Assistant Lecturer
salma011101@med.sohag.edu.eg01091285241

Outcome results

None listed

Source: ClinicalTrials.gov · Data processed: Feb 10, 2026