Skip to content

Gut Microbiota Dysbiosis in Lupus Nephritis

Gut Microbiota Dysbiosis in Lupus Nephritis

Status
Not yet recruiting
Phases
Unknown
Study type
Observational
Source
ClinicalTrials.gov
Registry ID
NCT06231303
Enrollment
60
Registered
2024-01-30
Start date
2025-01-31
Completion date
2026-12-31
Last updated
2024-01-30

For informational purposes only — not medical advice. Sourced from public registries and may not reflect the latest updates. Terms

Conditions

Gut Microbiota Dysbiosis in Lupus Nepheritis

Brief summary

Evaluate dysbiosis of some intestinal microbiota in adult patients with lupus nephritis compared to healthy controls.

Detailed description

Systemic Lupus Erythematosus (SLE) is an autoimmune disease resulting in multi-organ inflammation with complex clinical manifestation including neuropsychiatric, lupus nephritis..etc. However, the actual cause of SLE is still unknown \[1\]. Various etiologies have been postulated which can be categorized into genetic and environmental such as age, gender, ultra-violet exposure, dietary intake, alcohol, and lifestyle behavior \[2\]. Lupus nephritis is one of the most severe manifestations of SLE with high mortality rate and 10% of them eventually develop end-stage renal disease within 5 years after diagnosis \[3,4\]. There are trillion of microbes inhabited human gut which dominated by 4 phyla; Firmicutes, Bacteroidetes, Proteobacteria and Actinobacteria. In healthy human gut, 98% of gut microbiota is dominated by Bacteroidetes and Firmicutes. Every species of gut microbiota play their own role in modulating immune system. Many factors could alter gut communities such as infant transition, dietary habit, age, gender and antibiotic consumption \[5, 6\]. Firmicutes responsive in fatty acids and carbohydrates absorption whereas Bacteroidetes correspond to polysaccharides absorption \[7\]. Recently, enormous reports highlighted on the association of autoimmune diseases with dysbiosis of gut microbiota \[8-11\], During the autoimmune disease condition, the symbiotic relationship is broken due to various factor such as dietary habit that change microbiota diversity. The decrease of microbial diversity was found in autoimmune diseases such as SLE and inflammatory bowel disease (IBD), presented by reduce commensal bacteria (Firmicutes and Bacteroidetes) and increase of detrimental bacteria (Proteobacteria and Actinobacteria) \[12\]. Alteration of gut microbiota expresses as Firmicutes/Bacteroidetes ratio (F/B) potentially act as the measurement for pathological condition in SLE patients which cause systemic inflammation. The decreased ratio of F/B microbiome in SLE patients occur either by the reduction in Firmicutes or increase abundance of Bacteroidetes \[13\]. In human study, altered short chain fatty acids (SCFA) fecal level in lupus patient with low F/B ratio suggest the potential link of gut absorption function with microbes \[14\]. Hence, it is necessary to identify the exact mechanism on how the gut microbiota promote SLE and LN pathogenesis in human studies.

Interventions

GENETICDNA extraction and PCR amplification

Microbial community genomic DNA extraction from fecal samples will be done using extraction kit in accordance with the manufacturer's instructions. The DNA extract will be checked on a 1% agarose gel, and the DNA concentration and purity will be determined using the NanoDrop 2000 UV-vis spectrophotometer. The hyper-variable region V3-V4 of the bacterial 16S rRNA gene will be amplified with the primer pair 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTATCTAAT) on a PCR thermocycler. PCR amplification of the 16S rRNA gene will performed as follows: Initial denaturation at 95 ℃ for 3 min. 27 cycles of denaturing at 95 ℃ for 30 s, annealing at 55 ℃ for 30 s, and extension at 72 ℃ for 45 s. Final extension step at 72 ℃ for 10 min and incubation at 10 ℃. The PCR product will then be used to quantify different bacterial species in stool samples of patients and controls using real time PCR.

Sponsors

Hager Zanaty
Lead SponsorOTHER

Study design

Observational model
COHORT
Time perspective
PROSPECTIVE

Eligibility

Sex/Gender
FEMALE
Age
18 Years to 50 Years

Inclusion criteria

* Adult male and female patients diagnosed with lupus nephritis. Adult age and sex matched healthy individuals will be included as a control group. Informed consent will be obtained from each study participant.

Exclusion criteria

* Subjects at age\<18 years. Diseases affecting the gut microbiota (e.g. chronic diarrhea, Crohn's disease, or ulcerative colitis). Patients on maintenance dialysis, with diabetes or pregnancy, using antibiotics, probiotics, prebiotics, or synbiotics in the previous 4 weeks. Patients with critical condition (hypertension emergency,urgency, acute myocardial infarction or stroke within the last 6 months) and suspected/confirmed renal vascular disease.

Design outcomes

Primary

MeasureTime frameDescription
Evaluate dysbiosis of some intestinal microbiota in adult patients with lupus nephritis compared to healthy controls.2 yearsEvaluate the relation of dysbiosis of some intestinal microbiota to the stage of lupus nephritis.

Contacts

Primary ContactHager Zanaty
hager.znaty.abd@aun.edu.eg01001228727
Backup ContactRasha Madkour, Lecturer
01090895666

Outcome results

None listed

Source: ClinicalTrials.gov · Data processed: Feb 4, 2026