Effect of Oryza Sativa l Extract to LPS, ZO-1, and Intestinal Microbiota in Obese Individuals

Obesity

Lipopolysaccharide, Zonula Occludens 1, Obesity, Oryza sativa, Anthocyanin, Intestinal Microbiota

Background : Obesity prevalence rises among adults and leads to morbidity and mortality due to subsequent inflammation pathway activation. This activation is induced by higher lipid consumption which activates the Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB) pathway and alters the microbiota profile. The Oryza sativa extract contains anthocyanin which possibly affects the microbiota composition and NF-kb pathway which eventually preserves the protective layer and tight junction of the epithelial cells. Therefore it is important to address the impact of this extract on these parameters. Objective : To assess the effect of Oryza sativa extract on microbiota profile (Lactobacillus, Firmicutes, Bacteroides, Bifidobacteria, and Escherichia coli), Lipopolysaccharide/ LPS, and the tight epithelial junction (Zonula Occludens-1) among obese adults. Method: A two-arm Quasi-Experimental will be conducted, followed by two repeated measurements, at the baseline and 3 weeks after intervention Hypothesis: Oryza sativa extract lowers the LPS level, Firmicutes sp, Bacteroides sp, and increases ZO1 protein, Bifidobacteria, and Lactobacillus sp.

Method: 1. Non Randomized clinical trial with double-blind 2. Participants will be recruited consecutively 3. Matching technique will be applied following several variables adjustment 4. Two-arm of the group participants are the normal group, the obese control group, and the obese intervention group Sample size calculation: The difference between two independent means sample size calculation is applied following the elements below: a. Type 1 error: 10% b. Power: 80% c. Effect Size: 0.9 (based on changes of LPS value) d. Dropout rate: 20% e. Hypothesis: Superiority Trial g. The number of participants per group: 14 Intervention : 1. Extract: Liquid extract of Oryza sativa derived from 10 grams of Oryza sativa fine powder. The powder is mixed with 100 ml ethanol 50% and 0.5 ml of hydrochloric acid (HCl) in 300 C for 2 hours. A supernatant is extracted and evaporated at 35 C and dried and 60 C to remove any dissolving agents. This yields an extract of 624.27 mg. 2. Anthocyanin level is measured using a spectrophotometer where 20 microliters of extract added to 2 mL Potassium Chloride (KCl) (with pH 1.0) and 2 ml Sodium Acetate (NaCH3COO) (pH 4.5). Absorption of 500 nm and 700 nm waves are measured and calculated using the cyanide-3-glucoside calculation where : anthocyanin level : (absorbance x 449.2 x dilution factor x 1000) / 26.9 Control a. Active comparator using citric acid and sorbitol mixture Biological sample: 1. Serum sample preparation : Participants should undergo fasting for 12 hours. Blood is drawn from the cubital vein to the plain tube and incubated for 30-45 minutes. Centrifugation of sample is done for 15 minutes with 3000 rotation per minute to yield the serum. The supernatant then extracted and stored at -80 C. 2. Feces primary Polymerase Chain Reaction (PCR) using 100-gram feces. The PCR primer for intestinal microbiota are enlisted below : 1. Total intestinal microbiota (ACTCCTACGGGAGGCAGCAGT ATTACCGCGGCTGCTGGC), 2. Firmicutes-Lactobacillus (TACATCCCAACTCCAGAACGAAGCAACAGTACCACGACC)), 3. Bacteroidetes-Bacteroides fragilis (ATAGCCTTCGAAAGRAAGATCCAGTATCAACTGCAATTTTA), 4. Actinobacteria-Bifidobacterium (CTCCTGGAAACGGGGTGGGGTGTTCTTCCCGATATCTACA), 5. Proteobacteria-E.Coli (CATGCCGCGTGTATGAAGAACGGGTAACGTCAATGAGCAAA) Protection of Human subject according to Helsinki Declaration 1. Participants are allowed to receive the information of research including purpose, possible intervention, and side effects. 2. Possible side effect including : 3. Participants are allowed to withdraw from the study for any reason. Statistical Analysis Plan 1. Descriptive statistic of the baseline 2. The bivariate analysis between all variables and the outcomes 3. Paired t-test is intended to see the difference between microbiota profile, LPS, and ZO1 within groups 4. The independent-test to measure the difference in microbiota profile, LPS, and ZO1 value between groups 5. Alternative statistical test: Linear mixed model to adjust the fixed and random effects.

No related papers found yet.

Indonesia