Skip to content

Treatment Resistance Following Anti-cancer Therapies

TREATMENT RESISTANCE FOLLOWING ANTI-CANCER THERAPIES (TRANSLATE)

Status
Terminated
Phases
NA
Study type
Interventional
Source
ClinicalTrials.gov
Registry ID
NCT04436120
Enrollment
38
Registered
2020-06-17
Start date
2019-02-13
Completion date
2020-12-14
Last updated
2024-12-03

For informational purposes only — not medical advice. Sourced from public registries and may not reflect the latest updates. Terms

Conditions

Disease Progression

Keywords

Non Small Cell Lung Cancer, Renal Cell Carcinoma, HR+ HER2- Breast Cancer, Castrate-Resistant Prostate Cancer, Germline mutated BRCA, HER2- Breast Cancer

Brief summary

The TRANSLATE study aims to better understand why tumors become resistant to standard anti-cancer therapies. New tumor biopsy and blood samples are collected after disease progression on standard-of-care anti-cancer treatment and compared to the initial (archival) tumor biopsy sample taken from the same patient. Annotated reports of results from clinical Next Generation Sequencing (NGS) gene panel tests of both tumor and blood are sent directly from the testing lab to the study physician for discussion with the patient during the study. Patients may participate in interventional treatment clinical trials at the same time as participating in the TRANSLATE study. Primary data will be publicly available after the study to support further research.

Detailed description

Background: Development of new cancer treatments requires better understanding of why tumors develop resistance to standard-of-care (SOC) therapies. However, post-progression tumor biopsies are not routinely collected, limiting the tissue available to characterize mechanisms of treatment resistance. The TRANSLATE clinical study is specifically designed to address these critical gaps. Trial design: TRANSLATE is a global, multicenter, translational study designed to collect and compare archival pre-treatment tumor tissue with paired de novo tumor and blood samples obtained following disease progression on SOC therapies, targeting therapeutically important areas of cancer biology. Eligible Tumor Type and Most Recent SOC Therapy: * Non-small-cell lung and Anti-PD-1/-L1 monotherapy * Non-small-cell lung and Anti-PD-1/-L1 + platinum * Clear cell renal cell carcinoma and Anti-PD-1/-L1 monotherapy * Clear cell renal cell carcinoma and Doublet anti-PD-1/-L1 + anti-CTLA-4 * Clear cell renal cell carcinoma and Pembrolizumab + axitinib * Clear cell renal cell carcinoma and Avelumab + axitinib * HR+ HER2- breast and Palbociclib + hormonal therapy * germline mutated BRCA breast and Olaparib or talazoparib monotherapy * Castration-resistant prostate and Enzalutamide * Castration-resistant prostate and Abiraterone + prednisone Eligibility criteria include adults with locally advanced or metastatic tumors; radiographic evidence of progressive disease during the most recent SOC regimen; sufficient archival tumor tissue; and a post-progression tumor lesion that is safely accessible for a new biopsy. The results from clinical NGS panel testing may help inform subsequent treatment plan or identification of relevant interventional clinical trials. Patients are enrolled after disease progression on SOC and before change in treatment and participate in 3 study visits within approximately 3 months. Next-generation sequencing results from analysis of tumor tissue and blood will be returned to the study physician and patient for review at a subsequent study visit within this timeframe. The primary endpoint is the change in frequency of gene alterations between pre-treatment and post-progression tumor biopsies. Secondary endpoints address prioritized scientific hypotheses specific to each target area of biology and indication. Primary data will be publicly available after the study to support further research. Sponsored by Pfizer Inc.; EudraCT: 2018-003612-45.

Interventions

PROCEDUREDe novo tumor tissue biopsy

De novo tissue biopsy performed following disease progression

Blood biospecimens collected following disease progression

Sponsors

Pfizer
Lead SponsorINDUSTRY

Study design

Allocation
NA
Intervention model
SINGLE_GROUP
Primary purpose
OTHER
Masking
NONE

Eligibility

Sex/Gender
ALL
Age
18 Years to No maximum
Healthy volunteers
No

Inclusion criteria

* Histological diagnosis of locally advanced (primary or recurrent) or metastatic solid tumors treated as follows: * Non small cell lung carcinoma (NSCLC) monotherapy: Disease progression (PD) on 1st line monotherapy anti PD-1/ L1. * NSCLC combination: PD on 1st line anti PD-1/ L1 plus standard doublet platinum containing regimen; or PD on 1st-line anti-PD-1/-L1 plus standard doublet platinum-containing regimen followed by continuation of single agent anti-PD-1/-L1). * Renal cell carcinoma (RCC) with clear cell component: PD on 2nd line monotherapy anti PD-1/ L1; or PD on 1st line combination of doublet anti-PD-1/ L1 with anti-CTLA-4; or PD on 1st-line combination of avelumab with axitinib or pembrolizumab with axitinib. * HR+ HER2 adenocarcinoma of the breast: PD on 1st line combination of doublet palbociclib with hormonal therapy. * Castrate resistant adenocarcinoma of the prostate: PD on enzalutamide monotherapy. * Castrate resistant adenocarcinoma of the prostate: PD on abiraterone in combination with prednisone. * germline mutated BRCA (gBRCAm), HER2- breast cancer: PD on a PARP inhibitor monotherapy in patients previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting. * Radiographic evidence of PD, including the target lesion being subjected to biopsy for the study, on the most recent regimen that requires a change in anti-cancer treatment.

Exclusion criteria

* Tumor biopsy taken from a bone or an irradiated target lesion. * Discontinuation of current or most recent anti cancer therapy due to toxicity and not progressive disease. * Initiation of new anti-cancer therapy after disease progression prior to planned biopsy.

Design outcomes

Primary

MeasureTime frameDescription
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesThrough study completion, approximately 3 monthsChange in frequency is calculated by (frequency in de novo samples) - (frequency in archival samples). The frequency of each gene alteration is calculated as number of patients who harbored the alteration divided by the total number of patients in the cohort. Only gene alterations with variant allele frequency of 5% or greater were included in the analysis. Two different sequencing techniques were applied so 2 analysis sets were repeated for each cohort: targeted panel next-generation sequencing (NGS) and whole exome sequencing NGS.

Secondary

MeasureTime frameDescription
Overall Agreement Rate of Gene Alterations Between Post-Progression Tumor Biopsy and Blood NGS ResultsThrough study completion, approximately 3 monthsGenetic alterations detected in blood were compared to those detected in tissue. Only gene alterations with frequency of 5% or greater based on assessment of tumor biopsy were included in the analysis.
Change in Frequency of RB1 Gene Alterations Between Pre-Treatment Archival and Post-Progression SamplesThrough study completion, approximately 3 monthsMutations in RB1 gene associated with immune function, have also been shown to impact tumor immunogenicity and related with CDK4/6 inhibition. CDK4 or CDK6 complexed with cyclin D1 (CCND1) phosphorylates the retinoblastoma gene product (Rb), releasing the E2F and DP transcription factors that regulate the expression of genes required for entry into the S phase of the cell cycle. Calculation of change in frequency was decribed in the primary endpoint (Outcome Measure 1).
Percentage of Participants Who Carried the RB1 Gene Alterations in Post-Progression Blood cfDNAThrough study completion, approximately 3 monthsMutations in RB1 gene associated with immune function, have also been shown to impact tumor immunogenicity and related with CDK4/6 inhibition. CDK4 or CDK6 complexed with cyclin D1 (CCND1) phosphorylates the retinoblastoma gene product (Rb), releasing the E2F and DP transcription factors that regulate the expression of genes required for entry into the S phase of the cell cycle. Percentage of Participants Who Carried the RB1 Gene Alterations in Post Progression Blood cfDNA analysis was only conducted for Cohort 4 as per protocol.
Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortThrough study completion, approximately 3 monthsEstimating the number of fully biomarker evaluable population by cohort to evaluate the success rate in obtaining paired archival and post-progression tumor biopsies that were adequate to meet the objectives of the study
Percentage of Participants Who Carried the AR Gene Alterations in Post-Progression Blood cfDNAThrough study completion, approximately 3 monthsAndrogen receptor (AR) gene alterations can be evaluated as mechanisms of resistance to enzalutamide or abiraterone. Percentage of Participants Who Carried the AR Gene Alterations in Post-Progression Blood cfDNA analysis was conducted as it was only applicable to Cohorts 5 &6.
Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression SamplesThrough study completion, approximately 3 monthsThe differences in the expression of nuclear hormone receptor (HR) reflecting nuclear receptor pathway activity between the archival and de novo samples. Using HTG panel in BET \[targeted tumor RNA (TTR)\] population and Tempus RNAseq in BET \[whole transcriptome tumor RNA (WTTR)\] population. The unit of HTG expression data for nuclear hormone receptors is normalized expression counts. This Outcome Measure analysis was only conducted for Cohorts 5 & 6 as per protocol.
Change in Frequency of AR Gene Alterations Between Pre-Treatment Archival and Post-Progression SamplesThrough study completion, approximately 3 monthsPre-treatment archival tumor samples and post-progression de novo tumor biopsies were analyzed to identify molecular markers of resistance to selected anti-cancer therapies. Calculation of change in frequency was described for in the primary endpoint (Outcome Measure 1). AR gene Alterations analysis was only conducted for the Cohorts 5 & 6 as per protocol.

Countries

Argentina, Belgium, France, United Kingdom, United States

Participant flow

Pre-assignment details

A total of 38 participants were enrolled into 7 cohorts. The Safety Analysis (SA) population included 36 participants who had de novo biopsy or research blood draw performed.

Participants by arm

ArmCount
Cohort 1: NSCLC Monotherapy
Progressive disease on 1st line monotherapy anti-PD-1/-L1.
1
Cohort 2: NSCLC Combination
Progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen; or progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen followed by continuation of single agent anti-PD-1/-L1.
4
Cohort 3: RCC With Clear Cell Component
Progressive disease on 2nd line monotherapy anti-PD-1/-L1; or progressive disease on 1st line combination of doublet anti-PD-1/-L1 with anti-CTLA-4; or progressive disease on 1st line combination of avelumab with axitinib or pembrolizumab with axitinib.
5
Cohort 4: HR+ HER2- Adenocarcinoma of the Breast
Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy.
10
Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate
Progressive disease on enzalutamide monotherapy.
5
Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate
Progressive disease on abiraterone in combination with prednisone.
10
Cohort 7: gBRCAm HER2- Adenocarcinoma of the Breast
Progressive disease on a PARP inhibitor monotherapy in participants previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting.
1
Total36

Withdrawals & dropouts

PeriodReasonFG000FG001FG002FG003FG004FG005FG006
Overall Studyneither a de novo biopsy nor a research blood draw0001010

Baseline characteristics

CharacteristicCohort 7: gBRCAm HER2- Adenocarcinoma of the BreastTotalCohort 1: NSCLC MonotherapyCohort 2: NSCLC CombinationCohort 3: RCC With Clear Cell ComponentCohort 4: HR+ HER2- Adenocarcinoma of the BreastCohort 5: Castrate-resistant Adenocarcinoma of the ProstateCohort 6: Castrate-resistant Adenocarcinoma of the Prostate
Age, Continuous43.0 Years67.1 Years
STANDARD_DEVIATION 8.99
73.0 Years70.8 Years
STANDARD_DEVIATION 6.9
65.0 Years
STANDARD_DEVIATION 9.11
66.6 Years
STANDARD_DEVIATION 6.88
76.0 Years
STANDARD_DEVIATION 9.85
64.7 Years
STANDARD_DEVIATION 6.62
Ethnicity (NIH/OMB)
Hispanic or Latino
0 Participants6 Participants1 Participants0 Participants1 Participants3 Participants1 Participants0 Participants
Ethnicity (NIH/OMB)
Not Hispanic or Latino
0 Participants18 Participants0 Participants3 Participants3 Participants6 Participants3 Participants3 Participants
Ethnicity (NIH/OMB)
Unknown or Not Reported
1 Participants12 Participants0 Participants1 Participants1 Participants1 Participants1 Participants7 Participants
Race/Ethnicity, Customized
Multiracial
0 Participants1 Participants0 Participants0 Participants1 Participants0 Participants0 Participants0 Participants
Race/Ethnicity, Customized
Not reported
1 Participants7 Participants0 Participants0 Participants1 Participants0 Participants1 Participants4 Participants
Race/Ethnicity, Customized
White
0 Participants28 Participants1 Participants4 Participants3 Participants10 Participants4 Participants6 Participants
Sex: Female, Male
Female
1 Participants12 Participants0 Participants0 Participants1 Participants10 Participants0 Participants0 Participants
Sex: Female, Male
Male
0 Participants24 Participants1 Participants4 Participants4 Participants0 Participants5 Participants10 Participants

Adverse events

Event typeEG000
affected / at risk
EG001
affected / at risk
EG002
affected / at risk
EG003
affected / at risk
EG004
affected / at risk
EG005
affected / at risk
EG006
affected / at risk
deaths
Total, all-cause mortality
0 / 10 / 40 / 50 / 100 / 50 / 100 / 1
other
Total, other adverse events
0 / 10 / 40 / 51 / 101 / 50 / 100 / 1
serious
Total, serious adverse events
0 / 10 / 40 / 50 / 100 / 50 / 100 / 1

Outcome results

Primary

Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies

Change in frequency is calculated by (frequency in de novo samples) - (frequency in archival samples). The frequency of each gene alteration is calculated as number of patients who harbored the alteration divided by the total number of patients in the cohort. Only gene alterations with variant allele frequency of 5% or greater were included in the analysis. Two different sequencing techniques were applied so 2 analysis sets were repeated for each cohort: targeted panel next-generation sequencing (NGS) and whole exome sequencing NGS.

Time frame: Through study completion, approximately 3 months

Population: Number of Participants Analyzed shows the number of participants with available results for the corresponding gene alterations. Data for this outcome measure was not collected for Cohorts 1,2, 3 and 7 due to early termination of the study by Sponsor. Data for Cohorts 5 and 6 was combined to report combined results for Cohorts 5 and 6, to meet the sample size was deemed sufficient to generate informative summary statistics, as pre-specified in the Study Protocol.

ArmMeasureGroupValue (NUMBER)
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKMT2C c.2536delG0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDPYD c.1471G>T16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDYNC2H1 c.1714A>G-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesECH1 c.122A>C16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesERBB2 c.1958C>G16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesERBB2 c.2446C>T-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesERCC5 c.440C>G-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesESR1 c.1609T>A16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesESR1 c.1610_1613delATGAinsGTGG16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesESR1 c.1613A>G16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesARHGAP39 c.2000G>A16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFAM175A c.826_828delGAG-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFANCA c.2426G>A16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFANCD2 c.1214A>G-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFANCE c.17C>G-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMTHFR c.1286A>C16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMYB c.1781C>G0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRCA1 c.4837A>G16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNBN c.553G>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPALB2 c.2014G>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFOXA1 c.874G>T16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRCA1 c.4956G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPIK3CA c.1035T>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPIK3CA c.1633G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPIK3CA c.3140A>G0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPIK3CG c.41A>G-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPLCG2 c.2011A>G16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPMS2 c.13G>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPMS2 c.1408C>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRCA2 c.1114A>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPMS2 c.1621A>G0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPMS2 c.2570G>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRCA2 c.2803G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPTPN13 c.5683A>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRCA2 c.7397T>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPTPN13 c.6256T>G16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPUS3 c.1380G>C16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRIT1 c.625G>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRNF43 c.1252C>A16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesROS1 c.1775_1777delGTG0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCREBBP c.1792C>T16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSYNE1 c.18758G>A16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTCF3 c.737C>T-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTBC1D12 c.1246C>T-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTBC1D9B c.3356A>C16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTBX3 c.364G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZFHX3 c.10931G>T-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZFHX3 c.1135C>G16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZFHX3 c.1631C>T-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZFHX3 c.2833T>G-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRCA2 c.9976A>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesAKT1 c.238T>C16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRIP1 c.14G>C-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCDH1 c.466T>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCSF3R c.14G>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDNM2 c.1782-5delC0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFLT4 c.1019G>C16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRCA1 c.3113A>G16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRCA1 c.3548A>G16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFOXQ1 c.1013A>G-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKDM6A c.2859-5delT-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKDR c.2921G>T-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKMT2C c.4270C>T16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLMAN1 c.823-2dupA-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLRP1B c.143A>G16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLRP1B c.5737G>A-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLTN1 c.1717A>G16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMSH6 c.3557-4dupT16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesASXL1 c.1934dupG16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesJAK2 c.2743G>T16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesATM c.5948A>G0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNF1 c.7063-1G>T-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPMS2 c.1454C>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPMS2 c.89A>G0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPOLD1 c.2959delG-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPRKDC c.6424C>T-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPTCH1 c.3746C>T16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPTCH2 c.2134G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCBR3 c.730G>A16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPTPN13 c.4097T>A-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMUTYH c.1014G>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRAD51C c.376G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRSF1 c.3025G>C-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRAD51D c.494G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTBX3 c.820_827dupCCCGAAAC0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTERT c.215G>A16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTGFBR2 c.530-4T>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTP53 c.215C>G0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCCNE1 c.1117G>A-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCD22 c.757G>T-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTP53 c.388delC0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCD3EAP c.1516C>A16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTUSC3 c.99_101delGCT-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCDH1 c.1269delT0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFAT1 c.3818A>G16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFGF9 c.375T>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFGFR1 c.358+4G>A-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesIRS2 c.3170G>A16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFGFR1OP c.985-6_985-5dupTT-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFOXA1 c.247G>A16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFOXA1 c.801G>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesARHGAP39 c.2085G>C-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesARID1A c.3145_3146dupCT0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSF3B1 c.2077+4A>G16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesARID1A c.3977dupC0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesARID2 c.1803dupG0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesATM c.5557G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFOXQ1 c.895G>A16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFRS2 c.236G>T16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesITPKB c.1222T>G16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGATA2 c.527C>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSOD2 c.47T>C16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGATA3 c.1223_1224insA0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTP53 c.782+1G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGNAS c.521G>A16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGOT2 c.1037T>G16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHEATR1 c.6347-4_6347-3dupTT-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesIRF2 c.744G>A16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesJAK1 c.1252G>C16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesJAK3 c.757A>G16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLYN c.475G>T16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMAP2K4 c.179C>A-16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMED12 c.1364G>T16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMGMT c.520A>G16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMGMT c.626A>G16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMLH1 c.655A>G16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesAXIN1 c.1881G>T16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMSH2 c.1748A>G0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMSH6 c.116G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBAP1 c.179G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBCLAF1 c.615_619delATCAGinsGTCAT16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBCOR c.476C>A16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRCA1 c.2612C>T16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNBN c.683T>G0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNCOR1 c.4135G>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNCOR2 c.1597G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNF1 c.849T>G16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNOTCH1 c.2588-4G>A16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNOTCH2 c.3522+3G>A16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNOTCH3 c.539C>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRIP1 c.2755T>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNTRK1 c.1806-4delA16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNUP98 c.3310G>A16.7 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPALB2 c.1676A>G0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMUTYH c.1187G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesATM c.5948A>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZFHX3 c.11065A>G16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesAPLNR c.349G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCHD4 c.4060G>C-16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTEP1 c.3649C>T0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesEGFR c.1008G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPALB2 c.1676A>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRIP1 c.2755T>C0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTP53 c.993G>T-16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPMS2 c.1408C>T0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesEP300 c.6613A>C-16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesERCC6 c.3661C>T-16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesERG c.1455_1461delCTACTAA-16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesEZH2 c.848C>T0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFBXO11 c.164_169delAGCAGC16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFLT4 c.2405G>T-16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFOXO1 c.302C>T16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGNAQ c.303C>A-16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHOTS c.233_236delTACTinsCACC16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNF1 c.1082G>C0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMLH1 c.655A>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNOTCH2 c.17_18delCC-16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRAD51C c.376G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNTRK3 c.137G>C16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMSH6 c.116G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPALB2 c.2993G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTP53 c.994-2A>G16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPALLD c.270_275dupCCCGCC-16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPAX8 c.352G>A-16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTGFBR2 c.530-4T>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKMT2C c.4845G>A16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPDGFRB c.1543G>C-16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesU2AF1 c.101C>T-16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPIK3R1 c.1690A>G16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPIK3R1 c.935delC-16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPIK3R2 c.2047T>G16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRCA1 c.2612C>T0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKMT2B c.26G>A-16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPMS2 c.2570G>C33.3 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRCA1 c.3113A>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTP53 c.215C>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPMS2 c.1621A>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRCA1 c.3548A>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRNF139 c.135C>G-16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLRP1B c.4439G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKDM6A c.2859-5delT16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMAGEA10 c.1021G>T-16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTCF3 c.1643G>A-16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCARD11 c.988G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMAP3K1 c.4292A>T0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMET c.2318C>T0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMSH6 c.1186C>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRCA2 c.7397T>C0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMSH6 c.1486T>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMUTYH c.64G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesROS1 c.3416A>G16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMUTYH c.1014G>C0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMYH11 c.5819dupC16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPLCG1 c.1825C>T16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPLCG2 c.2114G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNBN c.553G>C-33.3 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRCA1 c.4837A>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSYNE1 c.25403G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPALB2 c.2014G>C0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPMS2 c.1789A>T0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPMS2 c.706-4delT16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPTEN c.900delC-16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPTPRD c.2069A>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRCA1 c.4956G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRB1 c.1466G>A16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSPOP c.260A>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesALK c.1043C>A16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesIRS2 c.1242C>A-16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKDM5C c.3019C>T-16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKIT c.597delA-16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKMT2A c.9400C>T16.7 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRCA2 c.1114A>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesACSL4 c.106G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesADAMTS13 c.3287G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesADAMTS7 c.227G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesADCY5 c.778C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesADGRE2 c.934C>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesADGRE3 c.1411G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesADGRF2 c.680C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesADGRG3 c.1394C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesADH4 c.1174delA-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesAEBP1 c.799G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesAGFG2 c.340C>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesAGPAT4 c.853C>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesAGRN c.3157G>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesARF6 c.352_354delCTC33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesARHGAP6 c.1585G>C33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesARHGEF1 c.2031_2033delGCT33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesARHGEF19 c.1379C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesARHGEF7 c.2072G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesARL10 c.53C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesARL6IP4 c.902_904delAGA-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesARRDC4 c.227C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesARSI c.312G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesASCC3 c.5962A>G0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesASH1L c.8522G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesASPRV1 c.985G>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesB4GALNT2 c.1414G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesB4GALT7 c.431T>C33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBEGAIN c.1231G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBEST1 c.273C>G-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBET1 c.327dupT-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBNC1 c.86G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBOC c.896G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesC3 c.3566_3567delTG33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesC5orf60 c.770G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesC7orf31 c.931A>G0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCACNA1C c.169G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCACNA1D c.26_28delAAA-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCACNA1D c.58C>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCACNA1I c.2939G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCACNA1S c.4718C>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCAD c.1429G>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCADPS c.1595G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCAPS2 c.158C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCATSPERE c.2471A>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCC2D1A c.1030C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCCDC105 c.895G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCCDC114 c.445G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCCDC142 c.1220G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCCDC22 c.442C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCCDC39 c.1189C>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCCDC47 c.21C>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCDK18 c.1073G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCDKN2A c.23G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCDX4 c.455G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCEBPZ c.2155T>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCELSR3 c.5802delC33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCELSR3 c.9748C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCENPE c.2797G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCENPE c.4270C>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCENPV c.596C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCHRNA5 c.1192G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCHST13 c.716G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCIZ1 c.626G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCLEC4F c.839G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCLIP4 c.890G>C-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCLSPN c.533G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCLTA c.698G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCLUH c.2743G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCMBL c.460G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesITGAE c.1350_1352delGGC33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesITIH5 c.2035C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKCNE5 c.370C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKCNG1 c.1226C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKCNN4 c.264G>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKCNQ4 c.2041G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKDM2A c.1939G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKIF13B c.5231G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKIF17 c.1204G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKLK2 c.259G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKMT2A c.5755G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKMT2B c.265G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLAMA5 c.104C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLAMA5 c.7771C>G0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLAMB2 c.2089C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLCE3D c.221G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLMNA c.356G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLMTK3 c.1696G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLOC100506388 c.217C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLOC441155 c.35dupT33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLOC729159 c.1004_1005delTGinsCA33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLPAR2 c.733A>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLRRC32 c.1573C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLRRC56 c.899G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLRRC59 c.510G>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMAD2L2 c.76G>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMADD c.2251G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMAEL c.329T>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMRE11 c.1532delA33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMRGPRE c.47G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMRGPRX4 c.69C>G0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMROH8 c.598G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMUC12 c.9229C>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMUC19 c.18689G>C33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFAM161B c.932G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFAM192A c.634C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFAM210B c.245A>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFAM50B c.307C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFAM86B2 c.892+5A>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFAM89A c.110C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFANCA c.4232C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFBXW10 c.1573G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFBXW12 c.174A>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFCF1 c.589C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFDX1L c.494C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFIP1L1 c.1180C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFKBP15 c.3637G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFLG c.5378G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFOXO4 c.574C>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFRAS1 c.5732A>G-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFRS3 c.1336_1344delACCCACCCTinsCCCCCCCCC33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFUT7 c.49G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGAREM1 c.1673G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGATAD2B c.1704G>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGGCT c.206C>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGGT5 c.1334C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGGT7 c.1093G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGOLGA2 c.1483C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGOLGA8K c.1702G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGOLGA8K c.962A>C33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGOLIM4 c.949C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGOLM1 c.179G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGPR6 c.715C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGPR83 c.321C>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGPR88 c.568G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGRN c.266C>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGSE1 c.1201G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGSG2 c.611G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGUCY2D c.2035G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGYG2 c.910C>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHCN1 c.808C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHDDC2 c.385G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHDLBP c.1417C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHEPHL1 c.3193G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHES2 c.13C>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHJURP c.520G>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHMGA2 c.275C>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHNRNPUL2 c.206G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRAPH1 c.1993G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRASAL3 c.2062G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHRG c.988G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHUNK c.1708C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHUWE1 c.11869C>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHYAL3 c.428G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHYDIN c.10541G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRBL1 c.294A>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRBM25 c.1438G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPADI2 c.95C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPALD1 c.1525G>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPARD3 c.3457C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRGPD3 c.2468A>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRGS20 c.1145C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRIMS4 c.597G>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRIMS4 c.730G>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRIOK3 c.1010C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRNASEL c.1419A>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRNF114 c.680A>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRNF123 c.3932C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRNF185 c.254G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRPAP3 c.1011delA-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRPL18 c.335G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRPL4 c.427C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRPS6KA2 c.1756G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRRBP1 c.2335G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRTN1 c.1600C>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRTP5 c.281G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSIGLEC9 c.17_19delTGC33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSIRPG c.1141G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSLC22A8 c.583G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSLC26A4 c.575T>C-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSLC44A3 c.332A>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSLC5A10 c.1211G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSLC6A13 c.1341C>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPCDHAC2 c.389C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPCSK5 c.1543A>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPDE12 c.806_807delTG-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPDGFRA c.1365-4C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPDGFRB c.2183+1G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPDX1 c.172G>C33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPDZRN3 c.2348C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPHLPP2 c.2843G>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPHOX2B c.811C>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPIN1 c.220C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPITPNC1 c.527G>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPKHD1 c.5814G>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPLCB1 c.2279G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPLEK2 c.458G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPLEKHA5 c.1070C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPOTEF c.505C>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPOU3F3 c.259G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPPEF1 c.735C>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPRAMEF11 c.1144A>C-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPREP c.815G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesQSOX2 c.994C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTSEN2 c.506G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTTK c.1324_1327delTCTA33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTTN c.68658G>C33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTTN c.68716C>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTTPA c.103G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTULP4 c.4571C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesVGLL2 c.794C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesWDFY3 c.1262T>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesWDR18 c.1075C>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesXKR4 c.1918A>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesXPO4 c.238C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZC3H12D c.1213C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZC3H7B c.1569C>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZDBF2 c.5228C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZC3H8 c.220G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZMPSTE24 c.1085dupT-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZMYM1 c.1965G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZMYND15 c.1468G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF276 c.548C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF365 c.307G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF367 c.854G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF383 c.820C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF420 c.34G>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF431 c.1462G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF431 c.1525G>C-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF493 c.802G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF536 c.3551A>C33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNFX1 c.1982C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZP1 c.1103G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesIGFN1 c.5683T>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesIQCH c.310C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKIAA1109 c.3686C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKIR2DS4 c.436A>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesONECUT2 c.751C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPARS2 c.599G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPHACTR1 c.1248G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPI4KA c.5701G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPOM121C c.1456A>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesQRICH2 c.3259G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRB1 c.2359C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRPS6KB2 c.37G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSALL3 c.1837G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSAMHD1 c.405_421delCATTGATACACCTCAAT0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSSC4D c.1154C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSSH2 c.2626G>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSSPO c.13487A>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSUDS3 c.397_399delAAG33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSLC8A1 c.2011A>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSLC8A3 c.2374G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSLIT3 c.182G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSMARCA4 c.4185delA33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSP140 c.2167G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSP8 c.326G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSPATA31A6 c.1997A>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSPATA31E1 c.2987G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSREBF2 c.85G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSSPO c.1967G>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSSTR1 c.121C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSTAC3 c.226_227insGGG-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSTK26 c.1073C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSTK33 c.1280G>C33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTFRC c.1763G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTGM4 c.937G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTHEMIS2 c.1527_1531delTGTGAinsCGTGG33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTIGD4 c.373G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTLN1 c.7088C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTMC6 c.2054G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTMEM59L c.800G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTMEM63C c.2128C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTMEM70 c.113G>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTMEM94 c.859G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTNFSF18 c.355A>G-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTNRC18 c.3076A>C33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTNRC6B c.4934G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTOGARAM1 c.2390A>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTOP2B c.1057C>G0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTOP2B c.247G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTBL1X c.826C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTRIM64B c.377delG33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTRPV1 c.1753A>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesUBASH3B c.32G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF696 c.430C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTSEN2 c.247C>G0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesAGRN c.184C>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesANKRD61 c.323C>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesC1orf168 c.2134G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCARS2 c.1419C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCC2D2B c.312G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCCDC168 c.17281G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCCDC8 c.316G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCDC25A c.1517G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRCA2 c.1114A>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRCA2 c.7397T>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCNR1 c.982C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRCA2 c.9976A>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesESR1 c.1613A>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesING1 c.361C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesINTS9 c.1412G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesIQGAP2 c.4025G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesIQSEC3 c.1468G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesISM2 c.701C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesITGA1 c.3334G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesITGA9 c.1040C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKMT2C c.2536delG0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMYB c.1781C>G0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCOL22A1 c.379C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPALB2 c.2014G>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCOL6A5 c.5543G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPIK3CA c.1633G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPMS2 c.1454C>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPMS2 c.1621A>G0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPMS2 c.2570G>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCRH c.445G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPTPN13 c.5683A>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRIT1 c.625G>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesROS1 c.1775_1777delGTG0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSYNE1 c.18758G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZFHX3 c.2833T>G-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDOCK4 c.5740G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDOCK8 c.1205C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesECT2 c.619C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesENC1 c.206G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFBXO33 c.101_109delAGCTGCGAC33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTAF1D c.281delA33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTEKT4 c.824G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTET1 c.5408G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTEX264 c.875G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTFAP2E c.305C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTMCO6 c.464T>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTMEM151A c.3G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTMEM165 c.703C>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTMEM200B c.338G>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTMEM232 c.1045G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTMEM237 c.1159G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTPR c.583A>G0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDHRSX c.721G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDOCK11 c.307G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesEVC c.1168C>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFOXN4 c.455delC-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFSTL1 c.755G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGTPBP1 c.1339C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHCFC1 c.4873G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesARID1A c.3145_3146dupCT0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesATM c.5557G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesATM c.5948A>G0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHGSNAT c.1622C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRIP1 c.14G>C-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRIP1 c.2755T>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesITGA9 c.433C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTRDN c.1900G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTRIM61 c.365C>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesIGFN1 c.5179G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesJMJD7 c.889G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKATNA1 c.443G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesIGFN1 c.5695G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKRBA1 c.1058C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesIGSF9B c.932G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesIL12RB1 c.1097C>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesIL6ST c.1165G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesILF3 c.1480G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesINA c.41_43delCCT-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGATA2 c.527C>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGATA3 c.1223_1224insA0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMLH1 c.655A>G0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMSH6 c.116G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLRP1 c.4006G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNBN c.553G>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPELP1 c.2285C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNBN c.683T>G0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNOTCH3 c.539C>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPALB2 c.1676A>G0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesR3HCC1 c.309-1G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPMS2 c.1408C>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPTCH2 c.2134G>A0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPTPN13 c.4097T>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRAD51C c.376G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTP53 c.215C>G0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPGLYRP2 c.1711C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTP53 c.388delC0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPIEZO1 c.3107G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTSEN2 c.451G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF568 c.1066C>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF680 c.1016A>G-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesAATK c.65C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesABCC9 c.4535C>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesACADS c.989G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesACAP3 c.1990C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesAHNAK2 c.13479G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesAHNAK2 c.9650T>C-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesAKNA c.3907T>C33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesALS2CL c.14A>G-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesANKS1A c.157_159delGGC-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesANKS1B c.2548C>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesANTXR1 c.1121A>C33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesANTXR2 c.940G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesAPC2 c.1312C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesAPLP1 c.1243C>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesATM c.3403-4dupT0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesATP13A2 c.2984C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesATP2C2 c.2192delA33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesATP6AP1 c.508A>C-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesATP7A c.3388C>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesATRN c.263_268delCGGCGG33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesB3GLCT c.517G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBPIFB4 c.1146G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRPF1 c.3069C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRPF1 c.823G>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRWD3 c.3188G>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBTBD17 c.106G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesC10orf88 c.401dupA-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesC16orf47 c.329G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesC16orf95 c.407G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesC17orf100 c.71C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesC17orf105 c.97G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesC1QL4 c.185G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesC1orf122 c.17G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCCDC70 c.239G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCCDC73 c.896C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCCDC91 c.1163C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCCP110 c.2504G>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCD3G c.497G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCD80 c.832G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCD9 c.85C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCDH13 c.1498G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCDH23 c.691G>C33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCEP170B c.1955T>C33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCEP170B c.3520C>G-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCEP250 c.589G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCFAP157 c.1441C>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCFHR4 c.996C>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCGB3 c.427G>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCHADL c.868C>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCHD2 c.2366G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCHD3 c.1796G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCHD3 c.3880G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCHPF c.2009A>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCLCN6 c.698G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCLCNKA c.476G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCLDN15 c.301C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCLEC3A c.547G>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesITLN2 c.176G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesITPK1 c.625G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesJPH3 c.1412C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesJPH3 c.1688G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesJSRP1 c.548C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKANK3 c.304G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKCNAB3 c.689G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKDM6A c.3068G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKIAA0586 c.397C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKIAA1324 c.1453G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKIF13A c.517C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKIF19 c.92C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKIF1B c.2119A>G-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKIF1C c.2522C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKIF21B c.4303G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKNDC1 c.3065C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKRTAP17-1 c.125G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKRTAP17-1 c.140G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKSR1 c.254C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLDOC1 c.417C>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLEMD3 c.1873C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLINC00452 c.718G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLIPN c.748A>G-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLKAAEAR1 c.182G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLMNA c.1634G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLRRC8D c.914A>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLRRN4 c.421A>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLRRN4 c.442C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLYST c.7192G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLZTR1 c.1892G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMAGEA10 c.145C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMAGEA5 c.181C>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMAGEL2 c.2626G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMAN2A1 c.1916dupA-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMANEA c.1096C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMAP7D1 c.2182A>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMARCH1 c.11G>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMARCH2 c.275G>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMAT1A c.280G>C33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMCCC1 c.667G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMCM6 c.1693C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMED12L c.5813C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMED23 c.2836C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMIB2 c.208C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMIER2 c.1453A>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMIGA2 c.508G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMIPEP c.1678C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMLIP c.1145C>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMMAB c.733G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMMP16 c.391C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMMP24 c.119_121delTGC-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMNT c.362C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMOV10L1 c.2459A>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMST1R c.931delG-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMTRNR2L3 c.2T>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMUC16 c.1031G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMUC4 c.7666G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMUC4 c.8866G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMUT c.1532G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMYBPC2 c.3193G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRAB21 c.41_43delCGG-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRAD50 c.1684G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMYH13 c.1440C>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMYH9 c.4049_4051delAGG33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMYLK3 c.1105C>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMYO7A c.1091delC33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNANOS1 c.517G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNBPF8 c.1714C>G-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNCAPG2 c.2617C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNCS1 c.250G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNEO1 c.3193G>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNFASC c.1747G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNISCH c.4270C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNKX2-5 c.211G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNLGN4X c.166C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNLRP3 c.226G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNOC2L c.994G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNOMO2 c.976G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNOTCH1 c.1892A>G-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNPHS1 c.3250delG-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNPTX2 c.979C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNTRK2 c.2272G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNUDT16 c.5C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNUDT7 c.259G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNUDT9 c.480delG33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNUFIP1 c.1336G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNUFIP1 c.415A>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNUP210 c.1159C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesOBSCN c.11180G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesOBSL1 c.4294C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesOGDHL c.2591-11_2600delTGGTCCCTCAGGGACCAGCTT-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesOPRM1 c.266C>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesOR8G5 c.716G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesOSBPL2 c.543delC33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesOVOL1 c.755C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPACS2 c.2428G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCNTD2 c.164C>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCOL11A2 c.3100C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCOL1A1 c.3680G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCOL22A1 c.3584G>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCOL27A1 c.2295C>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCOL4A1 c.3263G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCOL6A2 c.1267C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCRB2 c.2873G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCREB3L1 c.1267C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCRYBG2 c.1418_1419insGTCCCCCACCTGGAAAGAGGTCGTGAAGGGCCCTGGTGCTCCTGCTGCCTC33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCSMD1 c.1090G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCST9 c.289C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCT55 c.331A>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCTAGE4 c.1963A>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCTBP1 c.1130C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCTH c.589C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCTNNB1 c.1517T>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCTTNBP2 c.3100G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCXCR3 c.386G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCYBA c.437G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCYBB c.1461G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCYGB c.406G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCYP2F1 c.1028G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDAAM1 c.1015C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDAB2 c.2173C>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDACH1 c.1726C>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDALRD3 c.896A>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDDIAS c.2524G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDEF8 c.1414G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDEFB121 c.154G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDENND2C c.794G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDENND4A c.311G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDFFB c.379G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDGAT1 c.458G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDGKI c.40C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDNAH10 c.3640G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDNAH9 c.1243C>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDNAH9 c.6584A>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDOCK1 c.5259G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDOCK2 c.543C>G0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDOCK3 c.2086G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDRAM2 c.133G>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesEBPL c.20T>C-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesEFHC2 c.679G>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesEFHD1 c.88G>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesELMSAN1 c.939dupC33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesELOA2 c.1207G>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesENDOG c.142G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesERFE c.467C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesESX1 c.959_985delCTGTGCCACCCGGGCCGCCCATGGCGC-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesEVC2 c.2095A>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesEVI5 c.1213T>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesF8 c.3380G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFAAP100 c.22G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFAM135B c.2615G>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFAM160B2 c.305delC33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFAM212A c.216_218delGGA33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFAM219A c.499G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFAM220A c.266C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFASN c.4447G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFASTKD3 c.20G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFBXO3 c.7G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFBXW9 c.209G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFIGNL2 c.856G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFLII c.668G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFLNA c.6100C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFMR1 c.1544G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFOXD4 c.748_749delGGinsC33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFSCN2 c.853G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFSIP2 c.18617_18618delTA33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGJA9 c.595G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGLI2 c.4672G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGLRA4 c.440C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGLT8D2 c.278G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGMPPB c.887G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGNB1 c.983C>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGP9 c.131C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGPC1 c.1030G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGPR149 c.1041C>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGPR155 c.1384G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGPR52 c.18G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGPR50 c.514G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGRIA1 c.2318C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGRIA3 c.1913G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGRIA3 c.2431G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGRK7 c.1027G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGRK7 c.146G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHINT3 c.10G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHIP1 c.2956G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHIST1H2AL c.186G>C33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHIST2H3D c.19A>C33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHOXB9 c.232T>C33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHOXD4 c.121G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRAD54L2 c.1012A>G-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRALGAPA2 c.1332G>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesICAM3 c.869G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesIFI30 c.34C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesIFNA10 c.178C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesIFT81 c.1313G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRASAL3 c.2155G>C33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRASGRF2 c.123G>C33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRASGRP4 c.1501G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPCCB c.372G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPCDH9 c.3533C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPCDH9 c.923C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRBM43 c.167C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRBMXL3 c.1307G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRBPMS c.50A>G0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRFPL2 c.1018_1021delTTGCinsCTGT33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRFPL2 c.970A>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRNF185 c.558G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRNF214 c.412G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRNH1 c.433G>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRUNDC1 c.337C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRXFP2 c.604C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSACS c.2488G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSAP30L c.193G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSAPCD1 c.119G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSBSN c.1583A>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSCAP c.2892delC33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSEC14L1 c.1129C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSEC14L4 c.287G>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSEC24D c.907G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSH2D3C c.898C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSLC2A5 c.964G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSLC2A6 c.961G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSLC2A8 c.576delC-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSLC35F1 c.703G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPCDHB13 c.1966G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPCNX3 c.5516_5534delACTGTAGTGGGGGCGGTGG0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPCSK4 c.328C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPDE1B c.1220C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPDE1C c.1733G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPDGFRA c.2645G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPHACTR2 c.1429G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPHF8 c.1499G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPHF8 c.2385C>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPHLDB1 c.3146G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPID1 c.473C>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPIDD1 c.992A>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPIGG c.1087C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPIGG c.2061G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPLEKHG1 c.2273G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPLEKHM1 c.2174G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPLK5 c.505C>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPLXNB1 c.4699G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPNPT1 c.1285-3_1288delAAGTTTCinsTTTTTTT33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPODXL2 c.1217G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPOLR2A c.1492G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPOMT1 c.1648C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPRR14L c.3470A>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPRSS55 c.43G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPTPRS c.2192C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPTPRS c.2872C>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTXNRD2 c.1522C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesUBE4A c.2306G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesUSP32 c.2804G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesUSPL1 c.3256G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesXPO7 c.2398C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZAR1 c.1145C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZC3H12B c.2285G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZMYM5 c.74C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF10 c.1658C>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF207 c.673A>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF208 c.766T>C-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF37A c.1369C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF431 c.1260G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF474 c.757C>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF782 c.1630G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZYX c.697C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMUTYH c.1014G>C0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRAD51D c.494G>A0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSF3B1 c.2077+4A>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCHCHD10 c.227G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCX3CL1 c.1130C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDENND1A c.1343G>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSMARCAD1 c.1637G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSOBP c.1950G>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSOGA1 c.1477G>T0.0 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSOST c.278C>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSOX18 c.698C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSPINK2 c.118A>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSPIRE2 c.470_472delAGG-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSPOCD1 c.3199G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSTK38L c.148G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSTK40 c.1198G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSTT3B c.957T>G33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSUSD3 c.428C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSYCP2 c.4180C>T-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSYN2 c.544G>A-33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSYNE2 c.9263G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTACC2 c.2488C>T33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTACC2 c.3196G>A33.3 Percentage of Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTACC3 c.1847C>T-33.3 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF552 c.524_525dupGG50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTMEM26 c.709G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSKP1 c.21G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTMPRSS6 c.943G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTOP3B c.2299T>C50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTRIM28 c.335G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTRIM3 c.2235G>T0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTRIP12 c.1099C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTSPEAR c.59C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTVP23A c.271T>C50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesWASHC2C c.1562A>C50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesADGRF3 c.1615G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCOL19A1 c.1703G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFOXRED1 c.65G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesOR52D1 c.127G>T50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesOSMR c.937G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesOTOF c.5567G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPADI3 c.1739C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPCDH18 c.809C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPCDH8 c.1583G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPCLO c.2545G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPGLYRP3 c.551G>T0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPGS1 c.1069A>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPIGO c.3116delT0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRRN3 c.337A>G50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRSL1D1 c.1147-5_1147delCTTAGAinsTTTTTT50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRSPH3 c.1186G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPKD1 c.2647C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPLD3 c.464C>T0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPLK2 c.328G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPLXNA1 c.1114C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPLXND1 c.1393G>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPML c.1753delC-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPODXL2 c.1230delG-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPOLQ c.6811C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPOLR2B c.632delA-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPOM121 c.1916A>C50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPOM121C c.1162_1169delTTTGACTCinsCT0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPOTEB2 c.119C>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPPP1R12C c.1907C>G-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPPP2R2B c.1196G>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPPWD1 c.197-6_198delCTTCAGTCinsTTTTTTTT50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPRAMEF2 c.280C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPRKDC c.2601C>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPROSER1 c.1587G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPRR19 c.355C>T50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPRRT3 c.543G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPRSS56 c.1646G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPTPN13 c.4093G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesR3HDM2 c.79_80delAA0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRABGEF1 c.854C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRAD50 c.2165delA-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRAP2B c.56T>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRASGEF1A c.1062delC0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRBM15 c.1231G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRGPD1 c.4329A>C50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRGS17 c.55C>T0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRIMBP2 c.2627C>T0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRLBP1 c.307C>T0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRNF128 c.103G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRTTN c.5365G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesS100A7 c.139T>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSAMD13 c.169G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSHANK1 c.1366G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSHROOM2 c.2815C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSCN7A c.2098G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSCRIB c.4063C>T50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSDK1 c.1769C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSDK2 c.4706C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSEMA6D c.509C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSESN1 c.1469G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSFT2D3 c.314C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSHANK1 c.1329G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSLC30A10 c.1408C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSPTBN5 c.2405G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSPTLC1 c.1110C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesST7 c.1658G>C-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSTARD9 c.1654C>T50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSTK32A c.326G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSTRBP c.709C>T0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSVIL c.2083G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTFCP2L1 c.161C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTM4SF1 c.199T>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTMEM202 c.603C>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTMEM72 c.490G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTMPO c.514A>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTMPRSS6 c.435C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSLC25A12 c.887C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSLC2A11 c.995C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSLC38A2 c.549T>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSLC39A6 c.1088C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTMOD3 c.151C>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSLC5A2 c.236G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSLC7A14 c.1963T>C0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSLC7A9 c.887G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSLU7 c.576delA50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSOAT1 c.1421T>G50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSORBS1 c.3400G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSPATA31E1 c.2651G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSPPL2B c.634G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTNFAIP2 c.512_514delCGG50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesURI1 c.49G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesUSP28 c.2845C>T50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesUSP34 c.1142C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesVSTM2B c.457G>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesWASHC2C c.691G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesUGGT2 c.3474-467_3480del50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesATM c.5948A>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRIP1 c.2755T>C0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesIGFN1 c.5179G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesIGFN1 c.5683T>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesIGFN1 c.5695G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMSH6 c.116G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNBN c.553G>C0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTP53 c.215C>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCHD4 c.4060G>C0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesEGFR c.1008G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPALB2 c.2993G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPDGFRB c.1543G>C-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPIK3R2 c.2047T>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesATM c.3403-4dupT0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesADGRV1 c.16006C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesAFAP1 c.140A>G-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesAHNAK c.14273A>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesAHRR c.1881C>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesAKAP13 c.5222C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesAKR1B15 c.452delT-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesALS2CR12 c.1079C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesALX3 c.226G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesANKRD33 c.112G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesANXA10 c.655G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesAP4B1 c.1657G>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesAPPBP2 c.863C>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesC10orf76 c.1715T>C0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesC10orf82 c.343G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesC10orf95 c.581G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesC16orf86 c.922C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesC3 c.641C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCACFD1 c.665_668delCCCT-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCAMKK2 c.1599_1601delGACinsAACAAAA50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCAPN13 c.1888A>G-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCASKIN2 c.3538A>G-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCASQ2 c.51C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCCDC106 c.138G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCCDC114 c.601A>G50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCCDC144A c.1001C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCD1B c.418G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCD7 c.44C>G-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCDH17 c.1315G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCDK6 c.631G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCECR2 c.3651_3655dupAACCC0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCELSR1 c.5418G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCEP128 c.3073G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCEP290 c.5517G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCEP85L c.11G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCFAP36 c.685G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCFAP53 c.984_988delGAAACinsAAAAA50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCFAP65 c.2247G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCGB3 c.16-2A>T50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCHEK2 c.1409A>G-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCIZ1 c.346C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCLCN1 c.2435_2445delAGCCTGTCTGT50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCLCN3 c.1469G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCLDN19 c.503G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCLEC18C c.299T>C-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCLN5 c.272C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCLPTM1L c.1295T>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCNOT1 c.4630_4635delCTGTTAinsTTTTTT-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCNTN6 c.2759G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCOL11A2 c.2102C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCOL27A1 c.1908G>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCP c.2291C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCPB2 c.340delC50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCRYBG3 c.4646C>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCXCL6 c.86C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCXorf36 c.587G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCYP11B2 c.1471C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDCC c.601C>T50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDEPDC1B c.682G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDHRS2 c.287A>T0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDHX29 c.3296C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDLG5 c.2296G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDNAAF3 c.976G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDNAH9 c.6762G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDOLPP1 c.500A>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDSC2 c.934G>T0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesDST c.4384G>T0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesEML5 c.824G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesENAM c.869G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesENPEP c.1552G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesEOGT c.419C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesEPG5 c.6263T>G-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesEREG c.143G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesESRP2 c.381G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesEXOSC10 c.1751C>T50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesF13A1 c.1909-883_2038dup-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesF2RL1 c.280G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFAM186A c.4757_4828delAACTGGGGATCCCTCTCACCCCTCAGC AGGCGCAGGAACTGGGGATCCCTCTCACCCCTCAGCAGGC GCAGG50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFAM193A c.1769C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFAM90A1 c.1261G>T50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFAM9B c.285G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFANCI c.153C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFARSB c.1177C>T50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFAT1 c.10630G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFBL c.407C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFGF10 c.365C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFIG4 c.2347G>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFIG4 c.2586A>T0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGAGE2A c.175C>G50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGALR2 c.646C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGDF7 c.955C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGFRA1 c.665C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGGT1 c.1081G>C-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGHR c.1705C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGIPR c.301C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGOLGA8A c.1505G>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGOLGA8A c.1538G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGRIK4 c.2590C>T0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGRM7 c.2014G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesH2AFY c.10C>T0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHRH1 c.1048C>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHRNR c.7688G>C50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHSD17B12 c.682C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHSPG2 c.8873C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHUWE1 c.1553C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHUWE1 c.1924G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHUWE1 c.7633C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesITGAD c.2240G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesITPR2 c.8022G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesJKAMP c.158G>C0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesJPH3 c.169A>G-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKIAA0513 c.646G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKIAA1107 c.3310C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKIF5C c.226G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKLHL34 c.1513G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKLHL9 c.825T>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKLRK1 c.197G>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLCT c.1925C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLDB3 c.2012G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLILRB5 c.1274C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLMO7 c.1315T>C50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLOC100505841 c.50G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLOC101928841 c.3272G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMIER3 c.1113delG0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMMP2 c.1484G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMMP24 c.170_172delCGG50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMRPL21 c.581G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMRVI1 c.1446delA-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMUC12 c.13432C>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMUC12 c.2740T>C50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMUC12 c.4291G>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMUC12 c.5251A>C0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMUC12 c.5512C>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMUC4 c.8259_10034dup50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMVD c.665G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMX1 c.454G>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMYCBP2 c.1826C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMYCBP2 c.3572C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMYH14 c.2935G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMYOF c.1772_1773delAG-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNCKIPSD c.1430C>T50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNEB c.17635-2_17635delAGAinsTTT-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNEK1 c.739C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNEPRO c.837delA-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNEUROD6 c.89A>G-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNFATC1 c.179C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNLRP6 c.176C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNMD3 c.754G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNPHP3 c.1525-4_1526delCTAGTAinsTTTTTT50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNR2E1 c.592C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesOBSCN c.6543G>C0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesOR13C5 c.243_244delGC50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesOR2T2 c.612_618delCGTGCTG0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesOR2T2 c.785T>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesOR2T3 c.611T>C50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesOR2T8 c.590T>G-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF366 c.1475T>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF41 c.1700_1702delAAA0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF521 c.3122T>C0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF550 c.157C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTEX30 c.132_133delTC-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZSWIM6 c.82_84dupAGC50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRD3 c.292C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSCML2 c.654G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSCN1A c.1363C>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSEC24A c.2346C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSIX3 c.406_407delGC-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSYNE1 c.23551A>G50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSYNGR1 c.34G>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTACC2 c.798G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTCF7L1 c.40_42delGGC50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTCTN2 c.127G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSLC35F2 c.448G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSOCS6 c.781G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesSP140 c.205G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTNXB c.8806G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTOGARAM2 c.2090C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTRIM17 c.232C>T0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTRIO c.9289G>C0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTSHZ1 c.1204G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesTSSC4 c.538G>T0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPMS2 c.1621A>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesADCK2 c.253C>T0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRIX1 c.494T>C-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesC12orf56 c.989A>G-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCFAP97 c.481delA-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesENO4 c.1751A>T50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLMNA c.1977G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesUTF1 c.302C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesVSTM2B c.603C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesUBD c.3G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesUBE2O c.1813G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesUGDH c.1294delA-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRCA1 c.2612C>T0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRCA1 c.3113A>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRCA1 c.3548A>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRCA1 c.4837A>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBRCA2 c.7397T>C0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPALB2 c.1676A>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPALB2 c.2014G>C0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPMS2 c.2570G>C50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKMT2C c.4845G>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMUTYH c.64G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesPLCG2 c.2114G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRB1 c.1466G>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesROS1 c.3416A>G50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGOLGA8K c.1702G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesABCA5 c.725_727delCAGinsAAA50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesACSF3 c.1180C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesADAMTS2 c.2243C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesADGRA1 c.227G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesADGRG2 c.1314C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesAMOTL2 c.2426G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesANK3 c.9349dupA-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesARHGAP6 c.1393G>C0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesARID1A c.492_494delCGC-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesARMC12 c.829G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesARSE c.1750C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesATM c.458G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesATM c.6889C>G-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesATP10D c.545G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesATXN3 c.911_912insACAGCAGCAGCAGCAGCAGCAGCA-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesATXN7 c.59_61delCGG50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBCR c.3055G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesBTG2 c.17G>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCCDC168 c.15025G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCCDC25 c.137C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCCDC93 c.1321G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCCNI2 c.460G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCCNL2 c.532A>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesCCT3 c.591delA-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFNTA c.408C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFOXRED1 c.104C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesFXR2 c.994A>G-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGAB3 c.1307C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGKAP1 c.424G>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGKAP1 c.427G>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGKAP1 c.432C>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGLP1R c.16G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGLYATL2 c.680A>C-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGLYATL2 c.705A>C-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGLYR1 c.1120G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGMNN c.161G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGNRH2 c.40_42delCTG-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesGOLGA8A c.1463C>T50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHAUS5 c.425C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHERC1 c.11036G>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHIF3A c.1573C>T0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHOXA13 c.396_398delCGC50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesHOXD13 c.120C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesICAM4 c.38dupT-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesOR2W3 c.337C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesOR4C12 c.222_224delTTC-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesOR51A4 c.497_500delGAAAinsCAAG50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesIGFN1 c.5612A>G-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesIGFN1 c.5624C>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesIL12RB1 c.1442G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesILF2 c.40_41delGGinsTT0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesIQSEC3 c.973G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKIAA0895 c.720C>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKIAA1107 c.3152C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKMT5C c.1141dupC-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKNL1 c.1800G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKRT13 c.610G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesKRTAP9-9 c.35_36insACCTGCTGCAGGACC50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLCA5L c.1198G>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLCAT c.625C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLONRF3 c.712C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLRP2 c.13139dupC-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLRRC4 c.912_913delTG50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLRRC40 c.1457C>T50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLRRK1 c.644G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesLTBP1 c.307C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMADD c.3458C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMAP2K2 c.1069C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMAZ c.272C>T50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMED21 c.35T>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMED23 c.2276dupA-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMETTL5 c.388G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMICALL1 c.2475C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMUC12 c.5575G>A50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMUC12 c.5612C>T50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMUC16 c.17447G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMUC19 c.3641G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMUC4 c.3605T>C50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMUC4 c.7039A>T50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesMYOM3 c.221C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNALCN c.2063_2065delCCT0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNANOGNB c.495_501delGCATAAGinsAAAAAAA50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNBEA c.5218G>T50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNHS c.2203C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNLRP12 c.2971C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNLRP14 c.3228G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNRAP c.4058G>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNRG2 c.2084G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNUCB1 c.664C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNUP98 c.2972C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNYAP2 c.703G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesNYNRIN c.3662G>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesWDR33 c.160C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesWFS1 c.577_579delAAG-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesWISP1 c.580A>G-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesWWC1 c.2972T>G0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesYBX3 c.40_42delACC50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZFPM1 c.2596C>T-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF148 c.2380_2383delGGCTinsAA50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF185 c.1222G>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF221 c.335C>T50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF354C c.1060A>G50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF552 c.533T>G50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF628 c.794C>A-50.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesZNF883 c.664C>A0.0 Percentage of Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsChange in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor BiopsiesRBMX c.217-2_217-1delAGinsTT50.0 Percentage of Participants
Secondary

Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression Samples

The differences in the expression of nuclear hormone receptor (HR) reflecting nuclear receptor pathway activity between the archival and de novo samples. Using HTG panel in BET \[targeted tumor RNA (TTR)\] population and Tempus RNAseq in BET \[whole transcriptome tumor RNA (WTTR)\] population. The unit of HTG expression data for nuclear hormone receptors is normalized expression counts. This Outcome Measure analysis was only conducted for Cohorts 5 & 6 as per protocol.

Time frame: Through study completion, approximately 3 months

Population: BET (TTR) and BET (WTTR) population was all participants in the BET population who have results of TTR sample analysis, and all participants in the BET population who have results of WTTR NGS sample analysis, from both the archival and de novo biopsy tumor tissue biospecimen, respectively. One participant in Cohort 6 was included in the BET analysis population given the small number of eligible samples and the fact that participant's bone sample met analytical requirements.

ArmMeasureGroupValue (MEAN)
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression SamplesNR3C10.5 normalized expression counts
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression SamplesPGR-0.5 normalized expression counts
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression SamplesESR2-0.4 normalized expression counts
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression SamplesAR-0.7 normalized expression counts
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression SamplesESR10.3 normalized expression counts
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression SamplesPGR2.0 normalized expression counts
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression SamplesAR549.9 normalized expression counts
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression SamplesESR125.6 normalized expression counts
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression SamplesESR2-1.1 normalized expression counts
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression SamplesNR3C15.4 normalized expression counts
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression SamplesNR3C23.7 normalized expression counts
Secondary

Change in Frequency of AR Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples

Pre-treatment archival tumor samples and post-progression de novo tumor biopsies were analyzed to identify molecular markers of resistance to selected anti-cancer therapies. Calculation of change in frequency was described for in the primary endpoint (Outcome Measure 1). AR gene Alterations analysis was only conducted for the Cohorts 5 & 6 as per protocol.

Time frame: Through study completion, approximately 3 months

Population: The BET and BET (WETD) population was participants in the BE population who have a targeted tumor DNA panel biomarker result, and all participants in the BET population who have results of WETD NGS sample analysis, from both the archival and de novo biopsy tumor tissue biospecimen, respectively. One participant in Cohort 6 was included in the BET analysis population given the small number of eligible samples and the fact that participant's bone sample met analytical requirements.

ArmMeasureValue (NUMBER)
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in Frequency of AR Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples0.0 percentage of participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in Frequency of AR Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples0.0 percentage of participants
Secondary

Change in Frequency of RB1 Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples

Mutations in RB1 gene associated with immune function, have also been shown to impact tumor immunogenicity and related with CDK4/6 inhibition. CDK4 or CDK6 complexed with cyclin D1 (CCND1) phosphorylates the retinoblastoma gene product (Rb), releasing the E2F and DP transcription factors that regulate the expression of genes required for entry into the S phase of the cell cycle. Calculation of change in frequency was decribed in the primary endpoint (Outcome Measure 1).

Time frame: Through study completion, approximately 3 months

Population: The BET population was participants in the BE population who had a targeted tumor DNA panel biomarker result from both archival and de novo biopsy tumor tissue biospecimen. BET (WETD) was defined as all participants in the BET population who had results of WETD NGS sample analysis from both the archival and de novo biopsy tumor tissue biospecimen. RB1 Gene Alterations analysis was only conducted for Cohort 4 as per protocol.

ArmMeasureValue (NUMBER)
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsChange in Frequency of RB1 Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples0.0 Percentage of participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsChange in Frequency of RB1 Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples-33.3 Percentage of participants
Secondary

Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort

Estimating the number of fully biomarker evaluable population by cohort to evaluate the success rate in obtaining paired archival and post-progression tumor biopsies that were adequate to meet the objectives of the study

Time frame: Through study completion, approximately 3 months

Population: Participants included in the Safety Analysis population in 7 cohorts.

ArmMeasureGroupValue (COUNT_OF_PARTICIPANTS)
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortSafety Analysis (SA)1 Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortBiomarker Evaluable (BE)1 Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortBiomarker Evaluable Target (BET)0 Participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortFully Biomarker Evaluable (FBE)0 Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortFully Biomarker Evaluable (FBE)1 Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortBiomarker Evaluable Target (BET)1 Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortSafety Analysis (SA)4 Participants
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortBiomarker Evaluable (BE)4 Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortBiomarker Evaluable Target (BET)3 Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortBiomarker Evaluable (BE)5 Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortSafety Analysis (SA)5 Participants
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS ResultsNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortFully Biomarker Evaluable (FBE)1 Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortSafety Analysis (SA)10 Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortBiomarker Evaluable (BE)8 Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortBiomarker Evaluable Target (BET)6 Participants
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS ResultsNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortFully Biomarker Evaluable (FBE)1 Participants
Cohort 5: Castrate-resistant Adenocarcinoma of the ProstateNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortSafety Analysis (SA)5 Participants
Cohort 5: Castrate-resistant Adenocarcinoma of the ProstateNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortFully Biomarker Evaluable (FBE)1 Participants
Cohort 5: Castrate-resistant Adenocarcinoma of the ProstateNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortBiomarker Evaluable (BE)5 Participants
Cohort 5: Castrate-resistant Adenocarcinoma of the ProstateNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortBiomarker Evaluable Target (BET)4 Participants
Cohort 6: Castrate-resistant Adenocarcinoma of the ProstateNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortBiomarker Evaluable (BE)8 Participants
Cohort 6: Castrate-resistant Adenocarcinoma of the ProstateNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortSafety Analysis (SA)10 Participants
Cohort 6: Castrate-resistant Adenocarcinoma of the ProstateNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortBiomarker Evaluable Target (BET)2 Participants
Cohort 6: Castrate-resistant Adenocarcinoma of the ProstateNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortFully Biomarker Evaluable (FBE)0 Participants
Cohort 7: gBRCAm HER2- Adenocarcinoma of the BreastNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortBiomarker Evaluable Target (BET)1 Participants
Cohort 7: gBRCAm HER2- Adenocarcinoma of the BreastNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortSafety Analysis (SA)1 Participants
Cohort 7: gBRCAm HER2- Adenocarcinoma of the BreastNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortBiomarker Evaluable (BE)1 Participants
Cohort 7: gBRCAm HER2- Adenocarcinoma of the BreastNumber of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by CohortFully Biomarker Evaluable (FBE)0 Participants
Secondary

Overall Agreement Rate of Gene Alterations Between Post-Progression Tumor Biopsy and Blood NGS Results

Genetic alterations detected in blood were compared to those detected in tissue. Only gene alterations with frequency of 5% or greater based on assessment of tumor biopsy were included in the analysis.

Time frame: Through study completion, approximately 3 months

Population: Number of Participants Analyzed shows the number of participants with available results for the corresponding gene alterations. Data for this outcome measure was not collected for Cohorts 1,2, 3 and 7 due to early termination of the study by Sponsor. Data for Cohorts 5 and 6 was combined to report combined results for Cohorts 5 and 6, to meet the sample size was deemed sufficient to generate informative summary statistics, as pre-specified in the Study Protocol.

ArmMeasureValue (MEDIAN)
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsOverall Agreement Rate of Gene Alterations Between Post-Progression Tumor Biopsy and Blood NGS Results11.9 Percentage of agreed gene alterations
Castrate-resistant Adenocarcinoma of the Prostate With NGS ResultsOverall Agreement Rate of Gene Alterations Between Post-Progression Tumor Biopsy and Blood NGS Results0.0 Percentage of agreed gene alterations
Secondary

Percentage of Participants Who Carried the AR Gene Alterations in Post-Progression Blood cfDNA

Androgen receptor (AR) gene alterations can be evaluated as mechanisms of resistance to enzalutamide or abiraterone. Percentage of Participants Who Carried the AR Gene Alterations in Post-Progression Blood cfDNA analysis was conducted as it was only applicable to Cohorts 5 &6.

Time frame: Through study completion, approximately 3 months

Population: BE (TBD) was analyzed and defined as all participants in the BE population who have results of targeted blood cfDNA (TBD) NGS gene panel sample analysis from the post-progression blood sample.

ArmMeasureGroupValue (NUMBER)
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsPercentage of Participants Who Carried the AR Gene Alterations in Post-Progression Blood cfDNAc.2105T>A20.0 Percentage of participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsPercentage of Participants Who Carried the AR Gene Alterations in Post-Progression Blood cfDNAc.2202G>C10.0 Percentage of participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsPercentage of Participants Who Carried the AR Gene Alterations in Post-Progression Blood cfDNAc.2632A>G10.0 Percentage of participants
Secondary

Percentage of Participants Who Carried the RB1 Gene Alterations in Post-Progression Blood cfDNA

Mutations in RB1 gene associated with immune function, have also been shown to impact tumor immunogenicity and related with CDK4/6 inhibition. CDK4 or CDK6 complexed with cyclin D1 (CCND1) phosphorylates the retinoblastoma gene product (Rb), releasing the E2F and DP transcription factors that regulate the expression of genes required for entry into the S phase of the cell cycle. Percentage of Participants Who Carried the RB1 Gene Alterations in Post Progression Blood cfDNA analysis was only conducted for Cohort 4 as per protocol.

Time frame: Through study completion, approximately 3 months

Population: BE (TBD) was analyzed and defined as all participants in the BE population who have results of targeted blood cfDNA (TBD) NGS gene panel sample analysis from the post-progression blood sample.

ArmMeasureGroupValue (NUMBER)
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsPercentage of Participants Who Carried the RB1 Gene Alterations in Post-Progression Blood cfDNAc.151G>T12.5 Percentage of participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsPercentage of Participants Who Carried the RB1 Gene Alterations in Post-Progression Blood cfDNAc.184C>T12.5 Percentage of participants
HR+ HER2- Adenocarcinoma of the Breast With NGS ResultsPercentage of Participants Who Carried the RB1 Gene Alterations in Post-Progression Blood cfDNAc.54_79delGGAACCCCCGGCACCGCCGCCGCCGC12.5 Percentage of participants

Source: ClinicalTrials.gov · Data processed: Feb 4, 2026