Disease Progression
Conditions
Keywords
Non Small Cell Lung Cancer, Renal Cell Carcinoma, HR+ HER2- Breast Cancer, Castrate-Resistant Prostate Cancer, Germline mutated BRCA, HER2- Breast Cancer
Brief summary
The TRANSLATE study aims to better understand why tumors become resistant to standard anti-cancer therapies. New tumor biopsy and blood samples are collected after disease progression on standard-of-care anti-cancer treatment and compared to the initial (archival) tumor biopsy sample taken from the same patient. Annotated reports of results from clinical Next Generation Sequencing (NGS) gene panel tests of both tumor and blood are sent directly from the testing lab to the study physician for discussion with the patient during the study. Patients may participate in interventional treatment clinical trials at the same time as participating in the TRANSLATE study. Primary data will be publicly available after the study to support further research.
Detailed description
Background: Development of new cancer treatments requires better understanding of why tumors develop resistance to standard-of-care (SOC) therapies. However, post-progression tumor biopsies are not routinely collected, limiting the tissue available to characterize mechanisms of treatment resistance. The TRANSLATE clinical study is specifically designed to address these critical gaps. Trial design: TRANSLATE is a global, multicenter, translational study designed to collect and compare archival pre-treatment tumor tissue with paired de novo tumor and blood samples obtained following disease progression on SOC therapies, targeting therapeutically important areas of cancer biology. Eligible Tumor Type and Most Recent SOC Therapy: * Non-small-cell lung and Anti-PD-1/-L1 monotherapy * Non-small-cell lung and Anti-PD-1/-L1 + platinum * Clear cell renal cell carcinoma and Anti-PD-1/-L1 monotherapy * Clear cell renal cell carcinoma and Doublet anti-PD-1/-L1 + anti-CTLA-4 * Clear cell renal cell carcinoma and Pembrolizumab + axitinib * Clear cell renal cell carcinoma and Avelumab + axitinib * HR+ HER2- breast and Palbociclib + hormonal therapy * germline mutated BRCA breast and Olaparib or talazoparib monotherapy * Castration-resistant prostate and Enzalutamide * Castration-resistant prostate and Abiraterone + prednisone Eligibility criteria include adults with locally advanced or metastatic tumors; radiographic evidence of progressive disease during the most recent SOC regimen; sufficient archival tumor tissue; and a post-progression tumor lesion that is safely accessible for a new biopsy. The results from clinical NGS panel testing may help inform subsequent treatment plan or identification of relevant interventional clinical trials. Patients are enrolled after disease progression on SOC and before change in treatment and participate in 3 study visits within approximately 3 months. Next-generation sequencing results from analysis of tumor tissue and blood will be returned to the study physician and patient for review at a subsequent study visit within this timeframe. The primary endpoint is the change in frequency of gene alterations between pre-treatment and post-progression tumor biopsies. Secondary endpoints address prioritized scientific hypotheses specific to each target area of biology and indication. Primary data will be publicly available after the study to support further research. Sponsored by Pfizer Inc.; EudraCT: 2018-003612-45.
Interventions
De novo tissue biopsy performed following disease progression
Blood biospecimens collected following disease progression
Sponsors
Study design
Eligibility
Inclusion criteria
* Histological diagnosis of locally advanced (primary or recurrent) or metastatic solid tumors treated as follows: * Non small cell lung carcinoma (NSCLC) monotherapy: Disease progression (PD) on 1st line monotherapy anti PD-1/ L1. * NSCLC combination: PD on 1st line anti PD-1/ L1 plus standard doublet platinum containing regimen; or PD on 1st-line anti-PD-1/-L1 plus standard doublet platinum-containing regimen followed by continuation of single agent anti-PD-1/-L1). * Renal cell carcinoma (RCC) with clear cell component: PD on 2nd line monotherapy anti PD-1/ L1; or PD on 1st line combination of doublet anti-PD-1/ L1 with anti-CTLA-4; or PD on 1st-line combination of avelumab with axitinib or pembrolizumab with axitinib. * HR+ HER2 adenocarcinoma of the breast: PD on 1st line combination of doublet palbociclib with hormonal therapy. * Castrate resistant adenocarcinoma of the prostate: PD on enzalutamide monotherapy. * Castrate resistant adenocarcinoma of the prostate: PD on abiraterone in combination with prednisone. * germline mutated BRCA (gBRCAm), HER2- breast cancer: PD on a PARP inhibitor monotherapy in patients previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting. * Radiographic evidence of PD, including the target lesion being subjected to biopsy for the study, on the most recent regimen that requires a change in anti-cancer treatment.
Exclusion criteria
* Tumor biopsy taken from a bone or an irradiated target lesion. * Discontinuation of current or most recent anti cancer therapy due to toxicity and not progressive disease. * Initiation of new anti-cancer therapy after disease progression prior to planned biopsy.
Design outcomes
Primary
| Measure | Time frame | Description |
|---|---|---|
| Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | Through study completion, approximately 3 months | Change in frequency is calculated by (frequency in de novo samples) - (frequency in archival samples). The frequency of each gene alteration is calculated as number of patients who harbored the alteration divided by the total number of patients in the cohort. Only gene alterations with variant allele frequency of 5% or greater were included in the analysis. Two different sequencing techniques were applied so 2 analysis sets were repeated for each cohort: targeted panel next-generation sequencing (NGS) and whole exome sequencing NGS. |
Secondary
| Measure | Time frame | Description |
|---|---|---|
| Overall Agreement Rate of Gene Alterations Between Post-Progression Tumor Biopsy and Blood NGS Results | Through study completion, approximately 3 months | Genetic alterations detected in blood were compared to those detected in tissue. Only gene alterations with frequency of 5% or greater based on assessment of tumor biopsy were included in the analysis. |
| Change in Frequency of RB1 Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples | Through study completion, approximately 3 months | Mutations in RB1 gene associated with immune function, have also been shown to impact tumor immunogenicity and related with CDK4/6 inhibition. CDK4 or CDK6 complexed with cyclin D1 (CCND1) phosphorylates the retinoblastoma gene product (Rb), releasing the E2F and DP transcription factors that regulate the expression of genes required for entry into the S phase of the cell cycle. Calculation of change in frequency was decribed in the primary endpoint (Outcome Measure 1). |
| Percentage of Participants Who Carried the RB1 Gene Alterations in Post-Progression Blood cfDNA | Through study completion, approximately 3 months | Mutations in RB1 gene associated with immune function, have also been shown to impact tumor immunogenicity and related with CDK4/6 inhibition. CDK4 or CDK6 complexed with cyclin D1 (CCND1) phosphorylates the retinoblastoma gene product (Rb), releasing the E2F and DP transcription factors that regulate the expression of genes required for entry into the S phase of the cell cycle. Percentage of Participants Who Carried the RB1 Gene Alterations in Post Progression Blood cfDNA analysis was only conducted for Cohort 4 as per protocol. |
| Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Through study completion, approximately 3 months | Estimating the number of fully biomarker evaluable population by cohort to evaluate the success rate in obtaining paired archival and post-progression tumor biopsies that were adequate to meet the objectives of the study |
| Percentage of Participants Who Carried the AR Gene Alterations in Post-Progression Blood cfDNA | Through study completion, approximately 3 months | Androgen receptor (AR) gene alterations can be evaluated as mechanisms of resistance to enzalutamide or abiraterone. Percentage of Participants Who Carried the AR Gene Alterations in Post-Progression Blood cfDNA analysis was conducted as it was only applicable to Cohorts 5 &6. |
| Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression Samples | Through study completion, approximately 3 months | The differences in the expression of nuclear hormone receptor (HR) reflecting nuclear receptor pathway activity between the archival and de novo samples. Using HTG panel in BET \[targeted tumor RNA (TTR)\] population and Tempus RNAseq in BET \[whole transcriptome tumor RNA (WTTR)\] population. The unit of HTG expression data for nuclear hormone receptors is normalized expression counts. This Outcome Measure analysis was only conducted for Cohorts 5 & 6 as per protocol. |
| Change in Frequency of AR Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples | Through study completion, approximately 3 months | Pre-treatment archival tumor samples and post-progression de novo tumor biopsies were analyzed to identify molecular markers of resistance to selected anti-cancer therapies. Calculation of change in frequency was described for in the primary endpoint (Outcome Measure 1). AR gene Alterations analysis was only conducted for the Cohorts 5 & 6 as per protocol. |
Countries
Argentina, Belgium, France, United Kingdom, United States
Participant flow
Pre-assignment details
A total of 38 participants were enrolled into 7 cohorts. The Safety Analysis (SA) population included 36 participants who had de novo biopsy or research blood draw performed.
Participants by arm
| Arm | Count |
|---|---|
| Cohort 1: NSCLC Monotherapy Progressive disease on 1st line monotherapy anti-PD-1/-L1. | 1 |
| Cohort 2: NSCLC Combination Progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen; or progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen followed by continuation of single agent anti-PD-1/-L1. | 4 |
| Cohort 3: RCC With Clear Cell Component Progressive disease on 2nd line monotherapy anti-PD-1/-L1; or progressive disease on 1st line combination of doublet anti-PD-1/-L1 with anti-CTLA-4; or progressive disease on 1st line combination of avelumab with axitinib or pembrolizumab with axitinib. | 5 |
| Cohort 4: HR+ HER2- Adenocarcinoma of the Breast Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy. | 10 |
| Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate Progressive disease on enzalutamide monotherapy. | 5 |
| Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate Progressive disease on abiraterone in combination with prednisone. | 10 |
| Cohort 7: gBRCAm HER2- Adenocarcinoma of the Breast Progressive disease on a PARP inhibitor monotherapy in participants previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting. | 1 |
| Total | 36 |
Withdrawals & dropouts
| Period | Reason | FG000 | FG001 | FG002 | FG003 | FG004 | FG005 | FG006 |
|---|---|---|---|---|---|---|---|---|
| Overall Study | neither a de novo biopsy nor a research blood draw | 0 | 0 | 0 | 1 | 0 | 1 | 0 |
Baseline characteristics
| Characteristic | Cohort 7: gBRCAm HER2- Adenocarcinoma of the Breast | Total | Cohort 1: NSCLC Monotherapy | Cohort 2: NSCLC Combination | Cohort 3: RCC With Clear Cell Component | Cohort 4: HR+ HER2- Adenocarcinoma of the Breast | Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate | Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate |
|---|---|---|---|---|---|---|---|---|
| Age, Continuous | 43.0 Years | 67.1 Years STANDARD_DEVIATION 8.99 | 73.0 Years | 70.8 Years STANDARD_DEVIATION 6.9 | 65.0 Years STANDARD_DEVIATION 9.11 | 66.6 Years STANDARD_DEVIATION 6.88 | 76.0 Years STANDARD_DEVIATION 9.85 | 64.7 Years STANDARD_DEVIATION 6.62 |
| Ethnicity (NIH/OMB) Hispanic or Latino | 0 Participants | 6 Participants | 1 Participants | 0 Participants | 1 Participants | 3 Participants | 1 Participants | 0 Participants |
| Ethnicity (NIH/OMB) Not Hispanic or Latino | 0 Participants | 18 Participants | 0 Participants | 3 Participants | 3 Participants | 6 Participants | 3 Participants | 3 Participants |
| Ethnicity (NIH/OMB) Unknown or Not Reported | 1 Participants | 12 Participants | 0 Participants | 1 Participants | 1 Participants | 1 Participants | 1 Participants | 7 Participants |
| Race/Ethnicity, Customized Multiracial | 0 Participants | 1 Participants | 0 Participants | 0 Participants | 1 Participants | 0 Participants | 0 Participants | 0 Participants |
| Race/Ethnicity, Customized Not reported | 1 Participants | 7 Participants | 0 Participants | 0 Participants | 1 Participants | 0 Participants | 1 Participants | 4 Participants |
| Race/Ethnicity, Customized White | 0 Participants | 28 Participants | 1 Participants | 4 Participants | 3 Participants | 10 Participants | 4 Participants | 6 Participants |
| Sex: Female, Male Female | 1 Participants | 12 Participants | 0 Participants | 0 Participants | 1 Participants | 10 Participants | 0 Participants | 0 Participants |
| Sex: Female, Male Male | 0 Participants | 24 Participants | 1 Participants | 4 Participants | 4 Participants | 0 Participants | 5 Participants | 10 Participants |
Adverse events
| Event type | EG000 affected / at risk | EG001 affected / at risk | EG002 affected / at risk | EG003 affected / at risk | EG004 affected / at risk | EG005 affected / at risk | EG006 affected / at risk |
|---|---|---|---|---|---|---|---|
| deaths Total, all-cause mortality | 0 / 1 | 0 / 4 | 0 / 5 | 0 / 10 | 0 / 5 | 0 / 10 | 0 / 1 |
| other Total, other adverse events | 0 / 1 | 0 / 4 | 0 / 5 | 1 / 10 | 1 / 5 | 0 / 10 | 0 / 1 |
| serious Total, serious adverse events | 0 / 1 | 0 / 4 | 0 / 5 | 0 / 10 | 0 / 5 | 0 / 10 | 0 / 1 |
Outcome results
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
Change in frequency is calculated by (frequency in de novo samples) - (frequency in archival samples). The frequency of each gene alteration is calculated as number of patients who harbored the alteration divided by the total number of patients in the cohort. Only gene alterations with variant allele frequency of 5% or greater were included in the analysis. Two different sequencing techniques were applied so 2 analysis sets were repeated for each cohort: targeted panel next-generation sequencing (NGS) and whole exome sequencing NGS.
Time frame: Through study completion, approximately 3 months
Population: Number of Participants Analyzed shows the number of participants with available results for the corresponding gene alterations. Data for this outcome measure was not collected for Cohorts 1,2, 3 and 7 due to early termination of the study by Sponsor. Data for Cohorts 5 and 6 was combined to report combined results for Cohorts 5 and 6, to meet the sample size was deemed sufficient to generate informative summary statistics, as pre-specified in the Study Protocol.
| Arm | Measure | Group | Value (NUMBER) |
|---|---|---|---|
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KMT2C c.2536delG | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DPYD c.1471G>T | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DYNC2H1 c.1714A>G | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ECH1 c.122A>C | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ERBB2 c.1958C>G | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ERBB2 c.2446C>T | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ERCC5 c.440C>G | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ESR1 c.1609T>A | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ESR1 c.1610_1613delATGAinsGTGG | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ESR1 c.1613A>G | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ARHGAP39 c.2000G>A | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FAM175A c.826_828delGAG | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FANCA c.2426G>A | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FANCD2 c.1214A>G | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FANCE c.17C>G | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MTHFR c.1286A>C | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MYB c.1781C>G | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRCA1 c.4837A>G | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NBN c.553G>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PALB2 c.2014G>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FOXA1 c.874G>T | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRCA1 c.4956G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PIK3CA c.1035T>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PIK3CA c.1633G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PIK3CA c.3140A>G | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PIK3CG c.41A>G | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PLCG2 c.2011A>G | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PMS2 c.13G>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PMS2 c.1408C>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRCA2 c.1114A>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PMS2 c.1621A>G | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PMS2 c.2570G>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRCA2 c.2803G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PTPN13 c.5683A>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRCA2 c.7397T>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PTPN13 c.6256T>G | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PUS3 c.1380G>C | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RIT1 c.625G>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RNF43 c.1252C>A | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ROS1 c.1775_1777delGTG | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CREBBP c.1792C>T | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SYNE1 c.18758G>A | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TCF3 c.737C>T | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TBC1D12 c.1246C>T | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TBC1D9B c.3356A>C | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TBX3 c.364G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZFHX3 c.10931G>T | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZFHX3 c.1135C>G | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZFHX3 c.1631C>T | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZFHX3 c.2833T>G | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRCA2 c.9976A>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | AKT1 c.238T>C | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRIP1 c.14G>C | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CDH1 c.466T>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CSF3R c.14G>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DNM2 c.1782-5delC | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FLT4 c.1019G>C | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRCA1 c.3113A>G | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRCA1 c.3548A>G | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FOXQ1 c.1013A>G | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KDM6A c.2859-5delT | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KDR c.2921G>T | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KMT2C c.4270C>T | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LMAN1 c.823-2dupA | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LRP1B c.143A>G | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LRP1B c.5737G>A | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LTN1 c.1717A>G | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MSH6 c.3557-4dupT | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ASXL1 c.1934dupG | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | JAK2 c.2743G>T | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ATM c.5948A>G | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NF1 c.7063-1G>T | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PMS2 c.1454C>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PMS2 c.89A>G | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | POLD1 c.2959delG | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PRKDC c.6424C>T | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PTCH1 c.3746C>T | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PTCH2 c.2134G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CBR3 c.730G>A | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PTPN13 c.4097T>A | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MUTYH c.1014G>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RAD51C c.376G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RSF1 c.3025G>C | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RAD51D c.494G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TBX3 c.820_827dupCCCGAAAC | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TERT c.215G>A | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TGFBR2 c.530-4T>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TP53 c.215C>G | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CCNE1 c.1117G>A | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CD22 c.757G>T | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TP53 c.388delC | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CD3EAP c.1516C>A | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TUSC3 c.99_101delGCT | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CDH1 c.1269delT | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FAT1 c.3818A>G | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FGF9 c.375T>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FGFR1 c.358+4G>A | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | IRS2 c.3170G>A | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FGFR1OP c.985-6_985-5dupTT | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FOXA1 c.247G>A | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FOXA1 c.801G>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ARHGAP39 c.2085G>C | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ARID1A c.3145_3146dupCT | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SF3B1 c.2077+4A>G | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ARID1A c.3977dupC | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ARID2 c.1803dupG | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ATM c.5557G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FOXQ1 c.895G>A | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FRS2 c.236G>T | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ITPKB c.1222T>G | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GATA2 c.527C>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SOD2 c.47T>C | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GATA3 c.1223_1224insA | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TP53 c.782+1G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GNAS c.521G>A | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GOT2 c.1037T>G | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HEATR1 c.6347-4_6347-3dupTT | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | IRF2 c.744G>A | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | JAK1 c.1252G>C | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | JAK3 c.757A>G | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LYN c.475G>T | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MAP2K4 c.179C>A | -16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MED12 c.1364G>T | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MGMT c.520A>G | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MGMT c.626A>G | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MLH1 c.655A>G | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | AXIN1 c.1881G>T | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MSH2 c.1748A>G | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MSH6 c.116G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BAP1 c.179G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BCLAF1 c.615_619delATCAGinsGTCAT | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BCOR c.476C>A | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRCA1 c.2612C>T | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NBN c.683T>G | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NCOR1 c.4135G>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NCOR2 c.1597G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NF1 c.849T>G | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NOTCH1 c.2588-4G>A | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NOTCH2 c.3522+3G>A | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NOTCH3 c.539C>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRIP1 c.2755T>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NTRK1 c.1806-4delA | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NUP98 c.3310G>A | 16.7 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PALB2 c.1676A>G | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MUTYH c.1187G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ATM c.5948A>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZFHX3 c.11065A>G | 16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | APLNR c.349G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CHD4 c.4060G>C | -16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TEP1 c.3649C>T | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | EGFR c.1008G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PALB2 c.1676A>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRIP1 c.2755T>C | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TP53 c.993G>T | -16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PMS2 c.1408C>T | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | EP300 c.6613A>C | -16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ERCC6 c.3661C>T | -16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ERG c.1455_1461delCTACTAA | -16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | EZH2 c.848C>T | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FBXO11 c.164_169delAGCAGC | 16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FLT4 c.2405G>T | -16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FOXO1 c.302C>T | 16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GNAQ c.303C>A | -16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HOTS c.233_236delTACTinsCACC | 16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NF1 c.1082G>C | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MLH1 c.655A>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NOTCH2 c.17_18delCC | -16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RAD51C c.376G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NTRK3 c.137G>C | 16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MSH6 c.116G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PALB2 c.2993G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TP53 c.994-2A>G | 16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PALLD c.270_275dupCCCGCC | -16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PAX8 c.352G>A | -16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TGFBR2 c.530-4T>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KMT2C c.4845G>A | 16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PDGFRB c.1543G>C | -16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | U2AF1 c.101C>T | -16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PIK3R1 c.1690A>G | 16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PIK3R1 c.935delC | -16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PIK3R2 c.2047T>G | 16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRCA1 c.2612C>T | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KMT2B c.26G>A | -16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PMS2 c.2570G>C | 33.3 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRCA1 c.3113A>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TP53 c.215C>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PMS2 c.1621A>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRCA1 c.3548A>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RNF139 c.135C>G | -16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LRP1B c.4439G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KDM6A c.2859-5delT | 16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MAGEA10 c.1021G>T | -16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TCF3 c.1643G>A | -16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CARD11 c.988G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MAP3K1 c.4292A>T | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MET c.2318C>T | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MSH6 c.1186C>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRCA2 c.7397T>C | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MSH6 c.1486T>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MUTYH c.64G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ROS1 c.3416A>G | 16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MUTYH c.1014G>C | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MYH11 c.5819dupC | 16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PLCG1 c.1825C>T | 16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PLCG2 c.2114G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NBN c.553G>C | -33.3 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRCA1 c.4837A>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SYNE1 c.25403G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PALB2 c.2014G>C | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PMS2 c.1789A>T | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PMS2 c.706-4delT | 16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PTEN c.900delC | -16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PTPRD c.2069A>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRCA1 c.4956G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RB1 c.1466G>A | 16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SPOP c.260A>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ALK c.1043C>A | 16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | IRS2 c.1242C>A | -16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KDM5C c.3019C>T | -16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KIT c.597delA | -16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KMT2A c.9400C>T | 16.7 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRCA2 c.1114A>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ACSL4 c.106G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ADAMTS13 c.3287G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ADAMTS7 c.227G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ADCY5 c.778C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ADGRE2 c.934C>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ADGRE3 c.1411G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ADGRF2 c.680C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ADGRG3 c.1394C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ADH4 c.1174delA | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | AEBP1 c.799G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | AGFG2 c.340C>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | AGPAT4 c.853C>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | AGRN c.3157G>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ARF6 c.352_354delCTC | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ARHGAP6 c.1585G>C | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ARHGEF1 c.2031_2033delGCT | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ARHGEF19 c.1379C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ARHGEF7 c.2072G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ARL10 c.53C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ARL6IP4 c.902_904delAGA | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ARRDC4 c.227C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ARSI c.312G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ASCC3 c.5962A>G | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ASH1L c.8522G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ASPRV1 c.985G>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | B4GALNT2 c.1414G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | B4GALT7 c.431T>C | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BEGAIN c.1231G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BEST1 c.273C>G | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BET1 c.327dupT | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BNC1 c.86G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BOC c.896G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | C3 c.3566_3567delTG | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | C5orf60 c.770G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | C7orf31 c.931A>G | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CACNA1C c.169G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CACNA1D c.26_28delAAA | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CACNA1D c.58C>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CACNA1I c.2939G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CACNA1S c.4718C>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CAD c.1429G>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CADPS c.1595G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CAPS2 c.158C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CATSPERE c.2471A>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CC2D1A c.1030C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CCDC105 c.895G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CCDC114 c.445G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CCDC142 c.1220G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CCDC22 c.442C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CCDC39 c.1189C>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CCDC47 c.21C>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CDK18 c.1073G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CDKN2A c.23G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CDX4 c.455G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CEBPZ c.2155T>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CELSR3 c.5802delC | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CELSR3 c.9748C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CENPE c.2797G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CENPE c.4270C>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CENPV c.596C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CHRNA5 c.1192G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CHST13 c.716G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CIZ1 c.626G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CLEC4F c.839G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CLIP4 c.890G>C | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CLSPN c.533G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CLTA c.698G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CLUH c.2743G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CMBL c.460G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ITGAE c.1350_1352delGGC | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ITIH5 c.2035C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KCNE5 c.370C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KCNG1 c.1226C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KCNN4 c.264G>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KCNQ4 c.2041G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KDM2A c.1939G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KIF13B c.5231G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KIF17 c.1204G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KLK2 c.259G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KMT2A c.5755G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KMT2B c.265G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LAMA5 c.104C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LAMA5 c.7771C>G | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LAMB2 c.2089C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LCE3D c.221G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LMNA c.356G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LMTK3 c.1696G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LOC100506388 c.217C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LOC441155 c.35dupT | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LOC729159 c.1004_1005delTGinsCA | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LPAR2 c.733A>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LRRC32 c.1573C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LRRC56 c.899G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LRRC59 c.510G>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MAD2L2 c.76G>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MADD c.2251G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MAEL c.329T>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MRE11 c.1532delA | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MRGPRE c.47G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MRGPRX4 c.69C>G | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MROH8 c.598G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MUC12 c.9229C>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MUC19 c.18689G>C | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FAM161B c.932G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FAM192A c.634C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FAM210B c.245A>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FAM50B c.307C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FAM86B2 c.892+5A>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FAM89A c.110C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FANCA c.4232C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FBXW10 c.1573G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FBXW12 c.174A>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FCF1 c.589C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FDX1L c.494C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FIP1L1 c.1180C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FKBP15 c.3637G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FLG c.5378G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FOXO4 c.574C>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FRAS1 c.5732A>G | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FRS3 c.1336_1344delACCCACCCTinsCCCCCCCCC | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FUT7 c.49G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GAREM1 c.1673G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GATAD2B c.1704G>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GGCT c.206C>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GGT5 c.1334C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GGT7 c.1093G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GOLGA2 c.1483C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GOLGA8K c.1702G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GOLGA8K c.962A>C | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GOLIM4 c.949C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GOLM1 c.179G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GPR6 c.715C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GPR83 c.321C>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GPR88 c.568G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GRN c.266C>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GSE1 c.1201G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GSG2 c.611G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GUCY2D c.2035G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GYG2 c.910C>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HCN1 c.808C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HDDC2 c.385G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HDLBP c.1417C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HEPHL1 c.3193G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HES2 c.13C>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HJURP c.520G>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HMGA2 c.275C>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HNRNPUL2 c.206G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RAPH1 c.1993G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RASAL3 c.2062G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HRG c.988G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HUNK c.1708C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HUWE1 c.11869C>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HYAL3 c.428G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HYDIN c.10541G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RBL1 c.294A>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RBM25 c.1438G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PADI2 c.95C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PALD1 c.1525G>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PARD3 c.3457C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RGPD3 c.2468A>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RGS20 c.1145C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RIMS4 c.597G>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RIMS4 c.730G>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RIOK3 c.1010C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RNASEL c.1419A>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RNF114 c.680A>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RNF123 c.3932C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RNF185 c.254G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RPAP3 c.1011delA | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RPL18 c.335G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RPL4 c.427C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RPS6KA2 c.1756G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RRBP1 c.2335G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RTN1 c.1600C>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RTP5 c.281G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SIGLEC9 c.17_19delTGC | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SIRPG c.1141G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SLC22A8 c.583G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SLC26A4 c.575T>C | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SLC44A3 c.332A>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SLC5A10 c.1211G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SLC6A13 c.1341C>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PCDHAC2 c.389C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PCSK5 c.1543A>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PDE12 c.806_807delTG | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PDGFRA c.1365-4C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PDGFRB c.2183+1G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PDX1 c.172G>C | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PDZRN3 c.2348C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PHLPP2 c.2843G>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PHOX2B c.811C>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PIN1 c.220C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PITPNC1 c.527G>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PKHD1 c.5814G>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PLCB1 c.2279G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PLEK2 c.458G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PLEKHA5 c.1070C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | POTEF c.505C>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | POU3F3 c.259G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PPEF1 c.735C>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PRAMEF11 c.1144A>C | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PREP c.815G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | QSOX2 c.994C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TSEN2 c.506G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TTK c.1324_1327delTCTA | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TTN c.68658G>C | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TTN c.68716C>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TTPA c.103G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TULP4 c.4571C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | VGLL2 c.794C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | WDFY3 c.1262T>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | WDR18 c.1075C>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | XKR4 c.1918A>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | XPO4 c.238C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZC3H12D c.1213C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZC3H7B c.1569C>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZDBF2 c.5228C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZC3H8 c.220G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZMPSTE24 c.1085dupT | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZMYM1 c.1965G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZMYND15 c.1468G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF276 c.548C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF365 c.307G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF367 c.854G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF383 c.820C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF420 c.34G>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF431 c.1462G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF431 c.1525G>C | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF493 c.802G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF536 c.3551A>C | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNFX1 c.1982C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZP1 c.1103G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | IGFN1 c.5683T>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | IQCH c.310C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KIAA1109 c.3686C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KIR2DS4 c.436A>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ONECUT2 c.751C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PARS2 c.599G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PHACTR1 c.1248G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PI4KA c.5701G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | POM121C c.1456A>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | QRICH2 c.3259G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RB1 c.2359C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RPS6KB2 c.37G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SALL3 c.1837G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SAMHD1 c.405_421delCATTGATACACCTCAAT | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SSC4D c.1154C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SSH2 c.2626G>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SSPO c.13487A>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SUDS3 c.397_399delAAG | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SLC8A1 c.2011A>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SLC8A3 c.2374G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SLIT3 c.182G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SMARCA4 c.4185delA | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SP140 c.2167G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SP8 c.326G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SPATA31A6 c.1997A>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SPATA31E1 c.2987G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SREBF2 c.85G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SSPO c.1967G>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SSTR1 c.121C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | STAC3 c.226_227insGGG | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | STK26 c.1073C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | STK33 c.1280G>C | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TFRC c.1763G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TGM4 c.937G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | THEMIS2 c.1527_1531delTGTGAinsCGTGG | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TIGD4 c.373G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TLN1 c.7088C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TMC6 c.2054G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TMEM59L c.800G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TMEM63C c.2128C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TMEM70 c.113G>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TMEM94 c.859G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TNFSF18 c.355A>G | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TNRC18 c.3076A>C | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TNRC6B c.4934G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TOGARAM1 c.2390A>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TOP2B c.1057C>G | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TOP2B c.247G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TBL1X c.826C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TRIM64B c.377delG | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TRPV1 c.1753A>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | UBASH3B c.32G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF696 c.430C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TSEN2 c.247C>G | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | AGRN c.184C>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ANKRD61 c.323C>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | C1orf168 c.2134G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CARS2 c.1419C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CC2D2B c.312G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CCDC168 c.17281G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CCDC8 c.316G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CDC25A c.1517G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRCA2 c.1114A>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRCA2 c.7397T>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CNR1 c.982C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRCA2 c.9976A>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ESR1 c.1613A>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ING1 c.361C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | INTS9 c.1412G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | IQGAP2 c.4025G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | IQSEC3 c.1468G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ISM2 c.701C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ITGA1 c.3334G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ITGA9 c.1040C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KMT2C c.2536delG | 0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MYB c.1781C>G | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | COL22A1 c.379C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PALB2 c.2014G>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | COL6A5 c.5543G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PIK3CA c.1633G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PMS2 c.1454C>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PMS2 c.1621A>G | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PMS2 c.2570G>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CRH c.445G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PTPN13 c.5683A>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RIT1 c.625G>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ROS1 c.1775_1777delGTG | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SYNE1 c.18758G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZFHX3 c.2833T>G | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DOCK4 c.5740G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DOCK8 c.1205C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ECT2 c.619C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ENC1 c.206G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FBXO33 c.101_109delAGCTGCGAC | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TAF1D c.281delA | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TEKT4 c.824G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TET1 c.5408G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TEX264 c.875G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TFAP2E c.305C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TMCO6 c.464T>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TMEM151A c.3G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TMEM165 c.703C>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TMEM200B c.338G>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TMEM232 c.1045G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TMEM237 c.1159G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TPR c.583A>G | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DHRSX c.721G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DOCK11 c.307G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | EVC c.1168C>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FOXN4 c.455delC | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FSTL1 c.755G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GTPBP1 c.1339C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HCFC1 c.4873G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ARID1A c.3145_3146dupCT | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ATM c.5557G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ATM c.5948A>G | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HGSNAT c.1622C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRIP1 c.14G>C | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRIP1 c.2755T>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ITGA9 c.433C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TRDN c.1900G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TRIM61 c.365C>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | IGFN1 c.5179G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | JMJD7 c.889G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KATNA1 c.443G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | IGFN1 c.5695G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KRBA1 c.1058C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | IGSF9B c.932G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | IL12RB1 c.1097C>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | IL6ST c.1165G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ILF3 c.1480G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | INA c.41_43delCCT | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GATA2 c.527C>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GATA3 c.1223_1224insA | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MLH1 c.655A>G | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MSH6 c.116G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LRP1 c.4006G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NBN c.553G>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PELP1 c.2285C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NBN c.683T>G | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NOTCH3 c.539C>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PALB2 c.1676A>G | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | R3HCC1 c.309-1G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PMS2 c.1408C>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PTCH2 c.2134G>A | 0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PTPN13 c.4097T>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RAD51C c.376G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TP53 c.215C>G | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PGLYRP2 c.1711C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TP53 c.388delC | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PIEZO1 c.3107G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TSEN2 c.451G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF568 c.1066C>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF680 c.1016A>G | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | AATK c.65C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ABCC9 c.4535C>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ACADS c.989G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ACAP3 c.1990C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | AHNAK2 c.13479G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | AHNAK2 c.9650T>C | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | AKNA c.3907T>C | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ALS2CL c.14A>G | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ANKS1A c.157_159delGGC | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ANKS1B c.2548C>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ANTXR1 c.1121A>C | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ANTXR2 c.940G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | APC2 c.1312C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | APLP1 c.1243C>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ATM c.3403-4dupT | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ATP13A2 c.2984C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ATP2C2 c.2192delA | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ATP6AP1 c.508A>C | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ATP7A c.3388C>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ATRN c.263_268delCGGCGG | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | B3GLCT c.517G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BPIFB4 c.1146G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRPF1 c.3069C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRPF1 c.823G>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRWD3 c.3188G>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BTBD17 c.106G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | C10orf88 c.401dupA | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | C16orf47 c.329G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | C16orf95 c.407G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | C17orf100 c.71C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | C17orf105 c.97G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | C1QL4 c.185G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | C1orf122 c.17G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CCDC70 c.239G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CCDC73 c.896C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CCDC91 c.1163C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CCP110 c.2504G>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CD3G c.497G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CD80 c.832G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CD9 c.85C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CDH13 c.1498G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CDH23 c.691G>C | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CEP170B c.1955T>C | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CEP170B c.3520C>G | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CEP250 c.589G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CFAP157 c.1441C>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CFHR4 c.996C>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CGB3 c.427G>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CHADL c.868C>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CHD2 c.2366G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CHD3 c.1796G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CHD3 c.3880G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CHPF c.2009A>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CLCN6 c.698G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CLCNKA c.476G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CLDN15 c.301C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CLEC3A c.547G>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ITLN2 c.176G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ITPK1 c.625G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | JPH3 c.1412C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | JPH3 c.1688G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | JSRP1 c.548C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KANK3 c.304G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KCNAB3 c.689G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KDM6A c.3068G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KIAA0586 c.397C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KIAA1324 c.1453G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KIF13A c.517C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KIF19 c.92C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KIF1B c.2119A>G | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KIF1C c.2522C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KIF21B c.4303G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KNDC1 c.3065C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KRTAP17-1 c.125G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KRTAP17-1 c.140G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KSR1 c.254C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LDOC1 c.417C>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LEMD3 c.1873C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LINC00452 c.718G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LIPN c.748A>G | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LKAAEAR1 c.182G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LMNA c.1634G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LRRC8D c.914A>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LRRN4 c.421A>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LRRN4 c.442C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LYST c.7192G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LZTR1 c.1892G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MAGEA10 c.145C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MAGEA5 c.181C>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MAGEL2 c.2626G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MAN2A1 c.1916dupA | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MANEA c.1096C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MAP7D1 c.2182A>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MARCH1 c.11G>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MARCH2 c.275G>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MAT1A c.280G>C | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MCCC1 c.667G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MCM6 c.1693C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MED12L c.5813C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MED23 c.2836C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MIB2 c.208C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MIER2 c.1453A>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MIGA2 c.508G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MIPEP c.1678C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MLIP c.1145C>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MMAB c.733G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MMP16 c.391C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MMP24 c.119_121delTGC | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MNT c.362C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MOV10L1 c.2459A>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MST1R c.931delG | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MTRNR2L3 c.2T>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MUC16 c.1031G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MUC4 c.7666G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MUC4 c.8866G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MUT c.1532G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MYBPC2 c.3193G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RAB21 c.41_43delCGG | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RAD50 c.1684G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MYH13 c.1440C>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MYH9 c.4049_4051delAGG | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MYLK3 c.1105C>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MYO7A c.1091delC | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NANOS1 c.517G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NBPF8 c.1714C>G | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NCAPG2 c.2617C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NCS1 c.250G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NEO1 c.3193G>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NFASC c.1747G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NISCH c.4270C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NKX2-5 c.211G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NLGN4X c.166C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NLRP3 c.226G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NOC2L c.994G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NOMO2 c.976G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NOTCH1 c.1892A>G | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NPHS1 c.3250delG | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NPTX2 c.979C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NTRK2 c.2272G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NUDT16 c.5C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NUDT7 c.259G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NUDT9 c.480delG | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NUFIP1 c.1336G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NUFIP1 c.415A>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NUP210 c.1159C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | OBSCN c.11180G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | OBSL1 c.4294C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | OGDHL c.2591-11_2600delTGGTCCCTCAGGGACCAGCTT | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | OPRM1 c.266C>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | OR8G5 c.716G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | OSBPL2 c.543delC | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | OVOL1 c.755C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PACS2 c.2428G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CNTD2 c.164C>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | COL11A2 c.3100C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | COL1A1 c.3680G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | COL22A1 c.3584G>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | COL27A1 c.2295C>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | COL4A1 c.3263G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | COL6A2 c.1267C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CRB2 c.2873G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CREB3L1 c.1267C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CRYBG2 c.1418_1419insGTCCCCCACCTGGAAAGAGGTCGTGAAGGGCCCTGGTGCTCCTGCTGCCTC | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CSMD1 c.1090G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CST9 c.289C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CT55 c.331A>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CTAGE4 c.1963A>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CTBP1 c.1130C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CTH c.589C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CTNNB1 c.1517T>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CTTNBP2 c.3100G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CXCR3 c.386G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CYBA c.437G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CYBB c.1461G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CYGB c.406G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CYP2F1 c.1028G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DAAM1 c.1015C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DAB2 c.2173C>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DACH1 c.1726C>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DALRD3 c.896A>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DDIAS c.2524G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DEF8 c.1414G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DEFB121 c.154G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DENND2C c.794G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DENND4A c.311G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DFFB c.379G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DGAT1 c.458G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DGKI c.40C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DNAH10 c.3640G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DNAH9 c.1243C>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DNAH9 c.6584A>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DOCK1 c.5259G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DOCK2 c.543C>G | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DOCK3 c.2086G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DRAM2 c.133G>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | EBPL c.20T>C | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | EFHC2 c.679G>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | EFHD1 c.88G>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ELMSAN1 c.939dupC | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ELOA2 c.1207G>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ENDOG c.142G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ERFE c.467C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ESX1 c.959_985delCTGTGCCACCCGGGCCGCCCATGGCGC | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | EVC2 c.2095A>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | EVI5 c.1213T>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | F8 c.3380G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FAAP100 c.22G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FAM135B c.2615G>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FAM160B2 c.305delC | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FAM212A c.216_218delGGA | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FAM219A c.499G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FAM220A c.266C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FASN c.4447G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FASTKD3 c.20G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FBXO3 c.7G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FBXW9 c.209G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FIGNL2 c.856G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FLII c.668G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FLNA c.6100C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FMR1 c.1544G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FOXD4 c.748_749delGGinsC | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FSCN2 c.853G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FSIP2 c.18617_18618delTA | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GJA9 c.595G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GLI2 c.4672G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GLRA4 c.440C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GLT8D2 c.278G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GMPPB c.887G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GNB1 c.983C>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GP9 c.131C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GPC1 c.1030G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GPR149 c.1041C>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GPR155 c.1384G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GPR52 c.18G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GPR50 c.514G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GRIA1 c.2318C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GRIA3 c.1913G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GRIA3 c.2431G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GRK7 c.1027G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GRK7 c.146G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HINT3 c.10G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HIP1 c.2956G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HIST1H2AL c.186G>C | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HIST2H3D c.19A>C | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HOXB9 c.232T>C | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HOXD4 c.121G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RAD54L2 c.1012A>G | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RALGAPA2 c.1332G>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ICAM3 c.869G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | IFI30 c.34C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | IFNA10 c.178C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | IFT81 c.1313G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RASAL3 c.2155G>C | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RASGRF2 c.123G>C | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RASGRP4 c.1501G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PCCB c.372G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PCDH9 c.3533C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PCDH9 c.923C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RBM43 c.167C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RBMXL3 c.1307G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RBPMS c.50A>G | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RFPL2 c.1018_1021delTTGCinsCTGT | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RFPL2 c.970A>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RNF185 c.558G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RNF214 c.412G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RNH1 c.433G>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RUNDC1 c.337C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RXFP2 c.604C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SACS c.2488G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SAP30L c.193G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SAPCD1 c.119G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SBSN c.1583A>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SCAP c.2892delC | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SEC14L1 c.1129C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SEC14L4 c.287G>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SEC24D c.907G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SH2D3C c.898C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SLC2A5 c.964G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SLC2A6 c.961G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SLC2A8 c.576delC | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SLC35F1 c.703G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PCDHB13 c.1966G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PCNX3 c.5516_5534delACTGTAGTGGGGGCGGTGG | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PCSK4 c.328C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PDE1B c.1220C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PDE1C c.1733G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PDGFRA c.2645G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PHACTR2 c.1429G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PHF8 c.1499G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PHF8 c.2385C>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PHLDB1 c.3146G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PID1 c.473C>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PIDD1 c.992A>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PIGG c.1087C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PIGG c.2061G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PLEKHG1 c.2273G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PLEKHM1 c.2174G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PLK5 c.505C>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PLXNB1 c.4699G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PNPT1 c.1285-3_1288delAAGTTTCinsTTTTTTT | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PODXL2 c.1217G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | POLR2A c.1492G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | POMT1 c.1648C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PRR14L c.3470A>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PRSS55 c.43G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PTPRS c.2192C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PTPRS c.2872C>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TXNRD2 c.1522C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | UBE4A c.2306G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | USP32 c.2804G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | USPL1 c.3256G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | XPO7 c.2398C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZAR1 c.1145C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZC3H12B c.2285G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZMYM5 c.74C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF10 c.1658C>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF207 c.673A>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF208 c.766T>C | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF37A c.1369C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF431 c.1260G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF474 c.757C>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF782 c.1630G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZYX c.697C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MUTYH c.1014G>C | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RAD51D c.494G>A | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SF3B1 c.2077+4A>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CHCHD10 c.227G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CX3CL1 c.1130C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DENND1A c.1343G>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SMARCAD1 c.1637G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SOBP c.1950G>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SOGA1 c.1477G>T | 0.0 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SOST c.278C>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SOX18 c.698C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SPINK2 c.118A>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SPIRE2 c.470_472delAGG | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SPOCD1 c.3199G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | STK38L c.148G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | STK40 c.1198G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | STT3B c.957T>G | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SUSD3 c.428C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SYCP2 c.4180C>T | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SYN2 c.544G>A | -33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SYNE2 c.9263G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TACC2 c.2488C>T | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TACC2 c.3196G>A | 33.3 Percentage of Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TACC3 c.1847C>T | -33.3 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF552 c.524_525dupGG | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TMEM26 c.709G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SKP1 c.21G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TMPRSS6 c.943G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TOP3B c.2299T>C | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TRIM28 c.335G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TRIM3 c.2235G>T | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TRIP12 c.1099C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TSPEAR c.59C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TVP23A c.271T>C | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | WASHC2C c.1562A>C | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ADGRF3 c.1615G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | COL19A1 c.1703G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FOXRED1 c.65G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | OR52D1 c.127G>T | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | OSMR c.937G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | OTOF c.5567G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PADI3 c.1739C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PCDH18 c.809C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PCDH8 c.1583G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PCLO c.2545G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PGLYRP3 c.551G>T | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PGS1 c.1069A>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PIGO c.3116delT | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RRN3 c.337A>G | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RSL1D1 c.1147-5_1147delCTTAGAinsTTTTTT | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RSPH3 c.1186G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PKD1 c.2647C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PLD3 c.464C>T | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PLK2 c.328G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PLXNA1 c.1114C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PLXND1 c.1393G>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PML c.1753delC | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PODXL2 c.1230delG | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | POLQ c.6811C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | POLR2B c.632delA | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | POM121 c.1916A>C | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | POM121C c.1162_1169delTTTGACTCinsCT | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | POTEB2 c.119C>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PPP1R12C c.1907C>G | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PPP2R2B c.1196G>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PPWD1 c.197-6_198delCTTCAGTCinsTTTTTTTT | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PRAMEF2 c.280C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PRKDC c.2601C>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PROSER1 c.1587G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PRR19 c.355C>T | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PRRT3 c.543G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PRSS56 c.1646G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PTPN13 c.4093G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | R3HDM2 c.79_80delAA | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RABGEF1 c.854C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RAD50 c.2165delA | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RAP2B c.56T>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RASGEF1A c.1062delC | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RBM15 c.1231G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RGPD1 c.4329A>C | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RGS17 c.55C>T | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RIMBP2 c.2627C>T | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RLBP1 c.307C>T | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RNF128 c.103G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RTTN c.5365G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | S100A7 c.139T>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SAMD13 c.169G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SHANK1 c.1366G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SHROOM2 c.2815C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SCN7A c.2098G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SCRIB c.4063C>T | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SDK1 c.1769C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SDK2 c.4706C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SEMA6D c.509C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SESN1 c.1469G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SFT2D3 c.314C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SHANK1 c.1329G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SLC30A10 c.1408C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SPTBN5 c.2405G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SPTLC1 c.1110C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ST7 c.1658G>C | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | STARD9 c.1654C>T | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | STK32A c.326G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | STRBP c.709C>T | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SVIL c.2083G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TFCP2L1 c.161C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TM4SF1 c.199T>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TMEM202 c.603C>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TMEM72 c.490G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TMPO c.514A>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TMPRSS6 c.435C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SLC25A12 c.887C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SLC2A11 c.995C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SLC38A2 c.549T>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SLC39A6 c.1088C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TMOD3 c.151C>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SLC5A2 c.236G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SLC7A14 c.1963T>C | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SLC7A9 c.887G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SLU7 c.576delA | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SOAT1 c.1421T>G | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SORBS1 c.3400G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SPATA31E1 c.2651G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SPPL2B c.634G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TNFAIP2 c.512_514delCGG | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | URI1 c.49G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | USP28 c.2845C>T | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | USP34 c.1142C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | VSTM2B c.457G>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | WASHC2C c.691G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | UGGT2 c.3474-467_3480del | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ATM c.5948A>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRIP1 c.2755T>C | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | IGFN1 c.5179G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | IGFN1 c.5683T>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | IGFN1 c.5695G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MSH6 c.116G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NBN c.553G>C | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TP53 c.215C>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CHD4 c.4060G>C | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | EGFR c.1008G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PALB2 c.2993G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PDGFRB c.1543G>C | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PIK3R2 c.2047T>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ATM c.3403-4dupT | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ADGRV1 c.16006C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | AFAP1 c.140A>G | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | AHNAK c.14273A>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | AHRR c.1881C>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | AKAP13 c.5222C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | AKR1B15 c.452delT | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ALS2CR12 c.1079C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ALX3 c.226G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ANKRD33 c.112G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ANXA10 c.655G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | AP4B1 c.1657G>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | APPBP2 c.863C>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | C10orf76 c.1715T>C | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | C10orf82 c.343G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | C10orf95 c.581G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | C16orf86 c.922C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | C3 c.641C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CACFD1 c.665_668delCCCT | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CAMKK2 c.1599_1601delGACinsAACAAAA | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CAPN13 c.1888A>G | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CASKIN2 c.3538A>G | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CASQ2 c.51C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CCDC106 c.138G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CCDC114 c.601A>G | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CCDC144A c.1001C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CD1B c.418G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CD7 c.44C>G | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CDH17 c.1315G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CDK6 c.631G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CECR2 c.3651_3655dupAACCC | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CELSR1 c.5418G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CEP128 c.3073G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CEP290 c.5517G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CEP85L c.11G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CFAP36 c.685G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CFAP53 c.984_988delGAAACinsAAAAA | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CFAP65 c.2247G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CGB3 c.16-2A>T | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CHEK2 c.1409A>G | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CIZ1 c.346C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CLCN1 c.2435_2445delAGCCTGTCTGT | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CLCN3 c.1469G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CLDN19 c.503G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CLEC18C c.299T>C | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CLN5 c.272C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CLPTM1L c.1295T>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CNOT1 c.4630_4635delCTGTTAinsTTTTTT | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CNTN6 c.2759G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | COL11A2 c.2102C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | COL27A1 c.1908G>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CP c.2291C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CPB2 c.340delC | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CRYBG3 c.4646C>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CXCL6 c.86C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CXorf36 c.587G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CYP11B2 c.1471C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DCC c.601C>T | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DEPDC1B c.682G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DHRS2 c.287A>T | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DHX29 c.3296C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DLG5 c.2296G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DNAAF3 c.976G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DNAH9 c.6762G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DOLPP1 c.500A>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DSC2 c.934G>T | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | DST c.4384G>T | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | EML5 c.824G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ENAM c.869G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ENPEP c.1552G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | EOGT c.419C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | EPG5 c.6263T>G | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | EREG c.143G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ESRP2 c.381G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | EXOSC10 c.1751C>T | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | F13A1 c.1909-883_2038dup | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | F2RL1 c.280G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FAM186A c.4757_4828delAACTGGGGATCCCTCTCACCCCTCAGC AGGCGCAGGAACTGGGGATCCCTCTCACCCCTCAGCAGGC GCAGG | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FAM193A c.1769C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FAM90A1 c.1261G>T | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FAM9B c.285G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FANCI c.153C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FARSB c.1177C>T | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FAT1 c.10630G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FBL c.407C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FGF10 c.365C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FIG4 c.2347G>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FIG4 c.2586A>T | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GAGE2A c.175C>G | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GALR2 c.646C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GDF7 c.955C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GFRA1 c.665C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GGT1 c.1081G>C | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GHR c.1705C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GIPR c.301C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GOLGA8A c.1505G>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GOLGA8A c.1538G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GRIK4 c.2590C>T | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GRM7 c.2014G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | H2AFY c.10C>T | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HRH1 c.1048C>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HRNR c.7688G>C | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HSD17B12 c.682C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HSPG2 c.8873C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HUWE1 c.1553C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HUWE1 c.1924G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HUWE1 c.7633C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ITGAD c.2240G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ITPR2 c.8022G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | JKAMP c.158G>C | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | JPH3 c.169A>G | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KIAA0513 c.646G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KIAA1107 c.3310C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KIF5C c.226G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KLHL34 c.1513G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KLHL9 c.825T>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KLRK1 c.197G>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LCT c.1925C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LDB3 c.2012G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LILRB5 c.1274C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LMO7 c.1315T>C | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LOC100505841 c.50G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LOC101928841 c.3272G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MIER3 c.1113delG | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MMP2 c.1484G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MMP24 c.170_172delCGG | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MRPL21 c.581G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MRVI1 c.1446delA | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MUC12 c.13432C>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MUC12 c.2740T>C | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MUC12 c.4291G>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MUC12 c.5251A>C | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MUC12 c.5512C>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MUC4 c.8259_10034dup | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MVD c.665G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MX1 c.454G>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MYCBP2 c.1826C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MYCBP2 c.3572C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MYH14 c.2935G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MYOF c.1772_1773delAG | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NCKIPSD c.1430C>T | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NEB c.17635-2_17635delAGAinsTTT | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NEK1 c.739C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NEPRO c.837delA | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NEUROD6 c.89A>G | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NFATC1 c.179C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NLRP6 c.176C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NMD3 c.754G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NPHP3 c.1525-4_1526delCTAGTAinsTTTTTT | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NR2E1 c.592C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | OBSCN c.6543G>C | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | OR13C5 c.243_244delGC | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | OR2T2 c.612_618delCGTGCTG | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | OR2T2 c.785T>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | OR2T3 c.611T>C | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | OR2T8 c.590T>G | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF366 c.1475T>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF41 c.1700_1702delAAA | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF521 c.3122T>C | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF550 c.157C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TEX30 c.132_133delTC | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZSWIM6 c.82_84dupAGC | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RD3 c.292C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SCML2 c.654G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SCN1A c.1363C>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SEC24A c.2346C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SIX3 c.406_407delGC | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SYNE1 c.23551A>G | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SYNGR1 c.34G>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TACC2 c.798G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TCF7L1 c.40_42delGGC | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TCTN2 c.127G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SLC35F2 c.448G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SOCS6 c.781G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | SP140 c.205G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TNXB c.8806G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TOGARAM2 c.2090C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TRIM17 c.232C>T | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TRIO c.9289G>C | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TSHZ1 c.1204G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | TSSC4 c.538G>T | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PMS2 c.1621A>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ADCK2 c.253C>T | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRIX1 c.494T>C | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | C12orf56 c.989A>G | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CFAP97 c.481delA | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ENO4 c.1751A>T | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LMNA c.1977G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | UTF1 c.302C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | VSTM2B c.603C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | UBD c.3G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | UBE2O c.1813G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | UGDH c.1294delA | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRCA1 c.2612C>T | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRCA1 c.3113A>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRCA1 c.3548A>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRCA1 c.4837A>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BRCA2 c.7397T>C | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PALB2 c.1676A>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PALB2 c.2014G>C | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PMS2 c.2570G>C | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KMT2C c.4845G>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MUTYH c.64G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | PLCG2 c.2114G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RB1 c.1466G>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ROS1 c.3416A>G | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GOLGA8K c.1702G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ABCA5 c.725_727delCAGinsAAA | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ACSF3 c.1180C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ADAMTS2 c.2243C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ADGRA1 c.227G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ADGRG2 c.1314C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | AMOTL2 c.2426G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ANK3 c.9349dupA | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ARHGAP6 c.1393G>C | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ARID1A c.492_494delCGC | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ARMC12 c.829G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ARSE c.1750C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ATM c.458G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ATM c.6889C>G | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ATP10D c.545G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ATXN3 c.911_912insACAGCAGCAGCAGCAGCAGCAGCA | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ATXN7 c.59_61delCGG | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BCR c.3055G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | BTG2 c.17G>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CCDC168 c.15025G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CCDC25 c.137C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CCDC93 c.1321G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CCNI2 c.460G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CCNL2 c.532A>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | CCT3 c.591delA | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FNTA c.408C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FOXRED1 c.104C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | FXR2 c.994A>G | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GAB3 c.1307C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GKAP1 c.424G>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GKAP1 c.427G>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GKAP1 c.432C>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GLP1R c.16G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GLYATL2 c.680A>C | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GLYATL2 c.705A>C | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GLYR1 c.1120G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GMNN c.161G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GNRH2 c.40_42delCTG | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | GOLGA8A c.1463C>T | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HAUS5 c.425C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HERC1 c.11036G>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HIF3A c.1573C>T | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HOXA13 c.396_398delCGC | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | HOXD13 c.120C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ICAM4 c.38dupT | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | OR2W3 c.337C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | OR4C12 c.222_224delTTC | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | OR51A4 c.497_500delGAAAinsCAAG | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | IGFN1 c.5612A>G | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | IGFN1 c.5624C>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | IL12RB1 c.1442G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ILF2 c.40_41delGGinsTT | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | IQSEC3 c.973G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KIAA0895 c.720C>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KIAA1107 c.3152C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KMT5C c.1141dupC | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KNL1 c.1800G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KRT13 c.610G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | KRTAP9-9 c.35_36insACCTGCTGCAGGACC | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LCA5L c.1198G>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LCAT c.625C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LONRF3 c.712C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LRP2 c.13139dupC | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LRRC4 c.912_913delTG | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LRRC40 c.1457C>T | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LRRK1 c.644G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | LTBP1 c.307C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MADD c.3458C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MAP2K2 c.1069C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MAZ c.272C>T | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MED21 c.35T>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MED23 c.2276dupA | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | METTL5 c.388G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MICALL1 c.2475C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MUC12 c.5575G>A | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MUC12 c.5612C>T | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MUC16 c.17447G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MUC19 c.3641G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MUC4 c.3605T>C | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MUC4 c.7039A>T | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | MYOM3 c.221C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NALCN c.2063_2065delCCT | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NANOGNB c.495_501delGCATAAGinsAAAAAAA | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NBEA c.5218G>T | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NHS c.2203C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NLRP12 c.2971C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NLRP14 c.3228G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NRAP c.4058G>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NRG2 c.2084G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NUCB1 c.664C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NUP98 c.2972C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NYAP2 c.703G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | NYNRIN c.3662G>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | WDR33 c.160C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | WFS1 c.577_579delAAG | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | WISP1 c.580A>G | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | WWC1 c.2972T>G | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | YBX3 c.40_42delACC | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZFPM1 c.2596C>T | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF148 c.2380_2383delGGCTinsAA | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF185 c.1222G>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF221 c.335C>T | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF354C c.1060A>G | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF552 c.533T>G | 50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF628 c.794C>A | -50.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | ZNF883 c.664C>A | 0.0 Percentage of Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | RBMX c.217-2_217-1delAGinsTT | 50.0 Percentage of Participants |
Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression Samples
The differences in the expression of nuclear hormone receptor (HR) reflecting nuclear receptor pathway activity between the archival and de novo samples. Using HTG panel in BET \[targeted tumor RNA (TTR)\] population and Tempus RNAseq in BET \[whole transcriptome tumor RNA (WTTR)\] population. The unit of HTG expression data for nuclear hormone receptors is normalized expression counts. This Outcome Measure analysis was only conducted for Cohorts 5 & 6 as per protocol.
Time frame: Through study completion, approximately 3 months
Population: BET (TTR) and BET (WTTR) population was all participants in the BET population who have results of TTR sample analysis, and all participants in the BET population who have results of WTTR NGS sample analysis, from both the archival and de novo biopsy tumor tissue biospecimen, respectively. One participant in Cohort 6 was included in the BET analysis population given the small number of eligible samples and the fact that participant's bone sample met analytical requirements.
| Arm | Measure | Group | Value (MEAN) |
|---|---|---|---|
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression Samples | NR3C1 | 0.5 normalized expression counts |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression Samples | PGR | -0.5 normalized expression counts |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression Samples | ESR2 | -0.4 normalized expression counts |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression Samples | AR | -0.7 normalized expression counts |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression Samples | ESR1 | 0.3 normalized expression counts |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression Samples | PGR | 2.0 normalized expression counts |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression Samples | AR | 549.9 normalized expression counts |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression Samples | ESR1 | 25.6 normalized expression counts |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression Samples | ESR2 | -1.1 normalized expression counts |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression Samples | NR3C1 | 5.4 normalized expression counts |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression Samples | NR3C2 | 3.7 normalized expression counts |
Change in Frequency of AR Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples
Pre-treatment archival tumor samples and post-progression de novo tumor biopsies were analyzed to identify molecular markers of resistance to selected anti-cancer therapies. Calculation of change in frequency was described for in the primary endpoint (Outcome Measure 1). AR gene Alterations analysis was only conducted for the Cohorts 5 & 6 as per protocol.
Time frame: Through study completion, approximately 3 months
Population: The BET and BET (WETD) population was participants in the BE population who have a targeted tumor DNA panel biomarker result, and all participants in the BET population who have results of WETD NGS sample analysis, from both the archival and de novo biopsy tumor tissue biospecimen, respectively. One participant in Cohort 6 was included in the BET analysis population given the small number of eligible samples and the fact that participant's bone sample met analytical requirements.
| Arm | Measure | Value (NUMBER) |
|---|---|---|
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in Frequency of AR Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples | 0.0 percentage of participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in Frequency of AR Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples | 0.0 percentage of participants |
Change in Frequency of RB1 Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples
Mutations in RB1 gene associated with immune function, have also been shown to impact tumor immunogenicity and related with CDK4/6 inhibition. CDK4 or CDK6 complexed with cyclin D1 (CCND1) phosphorylates the retinoblastoma gene product (Rb), releasing the E2F and DP transcription factors that regulate the expression of genes required for entry into the S phase of the cell cycle. Calculation of change in frequency was decribed in the primary endpoint (Outcome Measure 1).
Time frame: Through study completion, approximately 3 months
Population: The BET population was participants in the BE population who had a targeted tumor DNA panel biomarker result from both archival and de novo biopsy tumor tissue biospecimen. BET (WETD) was defined as all participants in the BET population who had results of WETD NGS sample analysis from both the archival and de novo biopsy tumor tissue biospecimen. RB1 Gene Alterations analysis was only conducted for Cohort 4 as per protocol.
| Arm | Measure | Value (NUMBER) |
|---|---|---|
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Change in Frequency of RB1 Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples | 0.0 Percentage of participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Change in Frequency of RB1 Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples | -33.3 Percentage of participants |
Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort
Estimating the number of fully biomarker evaluable population by cohort to evaluate the success rate in obtaining paired archival and post-progression tumor biopsies that were adequate to meet the objectives of the study
Time frame: Through study completion, approximately 3 months
Population: Participants included in the Safety Analysis population in 7 cohorts.
| Arm | Measure | Group | Value (COUNT_OF_PARTICIPANTS) |
|---|---|---|---|
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Safety Analysis (SA) | 1 Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Biomarker Evaluable (BE) | 1 Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Biomarker Evaluable Target (BET) | 0 Participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Fully Biomarker Evaluable (FBE) | 0 Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Fully Biomarker Evaluable (FBE) | 1 Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Biomarker Evaluable Target (BET) | 1 Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Safety Analysis (SA) | 4 Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Biomarker Evaluable (BE) | 4 Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Biomarker Evaluable Target (BET) | 3 Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Biomarker Evaluable (BE) | 5 Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Safety Analysis (SA) | 5 Participants |
| HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Fully Biomarker Evaluable (FBE) | 1 Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Safety Analysis (SA) | 10 Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Biomarker Evaluable (BE) | 8 Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Biomarker Evaluable Target (BET) | 6 Participants |
| Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Fully Biomarker Evaluable (FBE) | 1 Participants |
| Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Safety Analysis (SA) | 5 Participants |
| Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Fully Biomarker Evaluable (FBE) | 1 Participants |
| Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Biomarker Evaluable (BE) | 5 Participants |
| Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Biomarker Evaluable Target (BET) | 4 Participants |
| Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Biomarker Evaluable (BE) | 8 Participants |
| Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Safety Analysis (SA) | 10 Participants |
| Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Biomarker Evaluable Target (BET) | 2 Participants |
| Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Fully Biomarker Evaluable (FBE) | 0 Participants |
| Cohort 7: gBRCAm HER2- Adenocarcinoma of the Breast | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Biomarker Evaluable Target (BET) | 1 Participants |
| Cohort 7: gBRCAm HER2- Adenocarcinoma of the Breast | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Safety Analysis (SA) | 1 Participants |
| Cohort 7: gBRCAm HER2- Adenocarcinoma of the Breast | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Biomarker Evaluable (BE) | 1 Participants |
| Cohort 7: gBRCAm HER2- Adenocarcinoma of the Breast | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Fully Biomarker Evaluable (FBE) | 0 Participants |
Overall Agreement Rate of Gene Alterations Between Post-Progression Tumor Biopsy and Blood NGS Results
Genetic alterations detected in blood were compared to those detected in tissue. Only gene alterations with frequency of 5% or greater based on assessment of tumor biopsy were included in the analysis.
Time frame: Through study completion, approximately 3 months
Population: Number of Participants Analyzed shows the number of participants with available results for the corresponding gene alterations. Data for this outcome measure was not collected for Cohorts 1,2, 3 and 7 due to early termination of the study by Sponsor. Data for Cohorts 5 and 6 was combined to report combined results for Cohorts 5 and 6, to meet the sample size was deemed sufficient to generate informative summary statistics, as pre-specified in the Study Protocol.
| Arm | Measure | Value (MEDIAN) |
|---|---|---|
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Overall Agreement Rate of Gene Alterations Between Post-Progression Tumor Biopsy and Blood NGS Results | 11.9 Percentage of agreed gene alterations |
| Castrate-resistant Adenocarcinoma of the Prostate With NGS Results | Overall Agreement Rate of Gene Alterations Between Post-Progression Tumor Biopsy and Blood NGS Results | 0.0 Percentage of agreed gene alterations |
Percentage of Participants Who Carried the AR Gene Alterations in Post-Progression Blood cfDNA
Androgen receptor (AR) gene alterations can be evaluated as mechanisms of resistance to enzalutamide or abiraterone. Percentage of Participants Who Carried the AR Gene Alterations in Post-Progression Blood cfDNA analysis was conducted as it was only applicable to Cohorts 5 &6.
Time frame: Through study completion, approximately 3 months
Population: BE (TBD) was analyzed and defined as all participants in the BE population who have results of targeted blood cfDNA (TBD) NGS gene panel sample analysis from the post-progression blood sample.
| Arm | Measure | Group | Value (NUMBER) |
|---|---|---|---|
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Percentage of Participants Who Carried the AR Gene Alterations in Post-Progression Blood cfDNA | c.2105T>A | 20.0 Percentage of participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Percentage of Participants Who Carried the AR Gene Alterations in Post-Progression Blood cfDNA | c.2202G>C | 10.0 Percentage of participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Percentage of Participants Who Carried the AR Gene Alterations in Post-Progression Blood cfDNA | c.2632A>G | 10.0 Percentage of participants |
Percentage of Participants Who Carried the RB1 Gene Alterations in Post-Progression Blood cfDNA
Mutations in RB1 gene associated with immune function, have also been shown to impact tumor immunogenicity and related with CDK4/6 inhibition. CDK4 or CDK6 complexed with cyclin D1 (CCND1) phosphorylates the retinoblastoma gene product (Rb), releasing the E2F and DP transcription factors that regulate the expression of genes required for entry into the S phase of the cell cycle. Percentage of Participants Who Carried the RB1 Gene Alterations in Post Progression Blood cfDNA analysis was only conducted for Cohort 4 as per protocol.
Time frame: Through study completion, approximately 3 months
Population: BE (TBD) was analyzed and defined as all participants in the BE population who have results of targeted blood cfDNA (TBD) NGS gene panel sample analysis from the post-progression blood sample.
| Arm | Measure | Group | Value (NUMBER) |
|---|---|---|---|
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Percentage of Participants Who Carried the RB1 Gene Alterations in Post-Progression Blood cfDNA | c.151G>T | 12.5 Percentage of participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Percentage of Participants Who Carried the RB1 Gene Alterations in Post-Progression Blood cfDNA | c.184C>T | 12.5 Percentage of participants |
| HR+ HER2- Adenocarcinoma of the Breast With NGS Results | Percentage of Participants Who Carried the RB1 Gene Alterations in Post-Progression Blood cfDNA | c.54_79delGGAACCCCCGGCACCGCCGCCGCCGC | 12.5 Percentage of participants |