Skip to content

Clinical Trial on Remote Ischemic Conditioning in Acute Ischemic Stroke Within 9 Hours of Onset in Patients Ineligible to Recanalization Therapies

Multi-center Randomized Pilot Clinical Trial on Remote Ischemic Conditioning in Acute Ischemic Stroke Within 9 Hours of Onset in Patients Ineligible to Recanalization Therapies

Status
Completed
Phases
NA
Study type
Interventional
Source
ClinicalTrials.gov
Registry ID
NCT04400981
Acronym
TRICS-9
Enrollment
80
Registered
2020-05-26
Start date
2021-08-01
Completion date
2024-08-30
Last updated
2024-12-12

For informational purposes only — not medical advice. Sourced from public registries and may not reflect the latest updates. Terms

Conditions

Ischemic Stroke

Keywords

remote ischemic conditioning, acute ischemic stroke, neuroprotection

Brief summary

Phase II, prospective, randomized, multicenter, open-label, pilot clinical trial comparing remote ischemic conditioning (RIC) plus standard medical therapy to standard medical therapy alone, in patients with acute ischemic stroke within 9 hours of stroke onset that are not eligible to recanalization therapies.

Detailed description

Funding: This study is supported by a grant from the Ministry of Health: PRIN 2017CY3J3W. This funding source had no role in the design of this study and will not have any role during its execution, analyses, interpretation of the data, reporting of the study or decision to submit results Background: Remote ischemic conditioning is an experimental therapy consisting in a transient ischemia applied in a certain body site, with the aim of increasing ischemic tolerance in distant organs through the activation of endogenous protective mechanisms. Ischemic per-conditioning is a sub-lethal ischemia applied while a harmful ischemia is ongoing, whereas ischemic post-conditioning is a sub-lethal ischemia applied subsequent to the occurrence of a harmful ischemia. Both of them have been proven to be neuroprotective to ischemic brain tissue in many exploratory single-centre pre-clinical studies. Although the neuroprotective mechanisms remain elusive, evidence supports the role of both humoral and neuronal factors, such as the release of adenosine, bradykinin and nitric oxide in the blood, the activation of neuronal p-AKT and of several miRNAs; a recent pre-clinical study, conducted on experimental rat model of acute ischemic stroke, also showed significantly increased mRNA levels of HIF-1α 24 hours after the application of remote ischemic conditioning, suggesting a possible neuroprotective role of HIF-1α. Remote ischemic conditioning represents a potential translational strategy; however, despite many pre-clinical exploratory studies highlighted its neuroprotective effect, only a few clinical trials have been conducted so far. RESCUE BRAIN is an ongoing multicenter clinical trial on remote ischemic conditioning applied within 6 hours of stroke onset through intermittent lower limb ischemia. The efficacy of remote ischemic conditioning has been assessed by measuring brain infarct growth from baseline to 24h through MRI DWI sequences and comparing brain infarct growth of a cohort of patients treated with remote ischemic conditioning plus standard medical therapy to that of a cohort treated with standard medical therapy alone. A potential limit of this trial is represented by the inclusion of stroke patients that received either or both thrombolysis and mechanical thrombectomy. In fact, as these treatments are highly effective if applied promptly, they may conceal the effect of remote ischemic conditioning when administered in addition to it, making it difficult to selectively investigate its efficacy. In a previous single-center clinical trial, remote ischemic per-conditioning, induced by intermittent upper arm ischemia, had been applied to patients with suspected acute ischemic stroke during transportation to hospital, as an adjunct to thrombolysis and prior to its administration. The efficacy of remote ischemic per-conditioning has been assessed by measuring penumbral salvage, final infarct size at 1 month, infarct growth at 1 month and evaluating clinical outcome after 3 months. Although the overall results were neutral, patients treated with remote ischemic per-conditioning showed lower NIHSS scores and higher frequency of TIA than controls, together with an overall reduction in risk of brain tissue infarction, suggesting a fast-acting neuroprotective effect; moreover, remote ischemic conditioning resulted to be safe and highly tolerable. The latter observation has also been confirmed in RECAST, a single-center study on tolerability and feasibility of remote ischemic conditioning applied to mildly symptomatic patients within 24h of stroke onset. The RECAST trial also demonstrated increased plasmatic levels of HSP27 at 4 days in the intervention group, suggesting its possible role in neuroprotection and indicating HSP27 as a potential biomarker of neuroprotection11. Based on these observations, the Italian Stroke Organization (ISO) Basic Science Network, which is a nationwide network that promotes translational research on acute ischemic stroke, launched a multicenter translational research program on remote ischemic conditioning. This program provided for a pre-clinical study on animal model of experimental ischemic stroke and a pilot clinical trial involving patients with acute ischemic stroke within 9 hours of stroke onset that are not eligible for recanalization therapies. Current guidelines for ischemic stroke recommend thrombolysis within 4.5 hours and thrombectomy within 6 hours of stroke onset for all eligible patients, but also allow administration of recanalization therapies beyond the abovementioned time window in selected patients, according to the results of DAWN, DEFUSE and WAKE-UP trial. The DAWN trial (Clinical Mismatch in the Triage of Wake Up and Late Presenting Strokes Undergoing Neurointervention With Trevo) used clinical-radiological mismatch to select patients with large anterior circulation vessel occlusion for mechanical thrombectomy 6 hours to 24 hours from last time known normal. The DEFUSE 3 trial (Diffusion and Perfusion Imaging Evaluation for Understanding Stroke Evolution) used perfusion-core mismatch and maximum core size as radiological criteria to select patients with large anterior circulation occlusion between 6 hours and 16 hours from last time known well for mechanical thrombectomy. Both trials demonstrated an overall benefit in functional outcome at 90 days in the subgroup of patients in the endovascular arm that were treated with mechanical thrombectomy \>6 hours from onset. The WAKE-UP trial (MRI-Guided Thrombolysis for Stroke with Unknown Time of Onset) enrolled patients with stroke on awakening or with unclear time of onset, and that presented with MRI mismatch between abnormal signal on DWI and no abnormalities on FLAIR. The patient either noticed stroke symptoms on awakening or could not report the timing of symptom onset due to neurological deficits (e.g. aphasia, anathria, confusion); the time interval between the patient was last known to be well and symptom recognition was \>4.5 hours (without upper limit) in order to exclude patients otherwise eligible to thrombolysis. This trial provided evidence of benefit from thrombolysis within 4.5 hours of stroke symptom recognition. Finally, the EXTEND trial (Thrombolysis Guided by Perfusion Imaging up to 9 Hours after Onset of Stroke) enrolled patients with stroke onset between 4,5 hours and 9 hours and those with stroke on awakening within 9 hours of the midpoint of sleep, who had salvageable brain tissue on perfusion imaging. This trial demonstrated that thrombolysis, performed between 4.5 and 9.0 hours after stroke onset or at the time the patient awoke with stroke symptoms (if within 9 hours of midpoint of sleep), resulted in a higher percentage of patients with no or minor neurologic deficits than those who were given placebo. These evidences lead to rethinking the paradigm time is brain, adding greater consciousness that time on the ischemic process is relative: although the longer treatment is delayed, the worse the functional outcome, penumbral transformation into irreversible brain injury within a given time interval varies in relation to multiple factors. In this context, the aim of this study is to explore remote ischemic conditioning as a neuroprotective therapy in acute ischemic stroke within an extended time window of 9 hours of stroke onset. Primary objective: to assess whether RIC plus standard medical therapy, applied within 9 hours of ischemic stroke onset, is superior to standard medical therapy alone in obtaining early neurological improvement, defined as the percent change in the National Institute of Health stroke scale (NIHSS) between admission and 72 hours after randomization, in patients with acute ischemic stroke ineligible for recanalization therapies. Secondary objectives: * Evaluate intervention feasibility, i.e. estimate the proportion of patients randomized to the active arm of the trial who successfully complete the RIC treatment * Estimate the added impact of the RIC therapy on the following outcomes: early neurological improvement at 24 hours and 48 hours after randomization; neuroprotection based on blood and plasma biomarkers; degree of disability or dependence in the daily activities at three months assessed by the modified Rankin Scale Trial design: Phase II, prospective, block randomized, multicenter, open-label, clinical trial comparing with a 1:1 allocation ratio RIC plus standard medical therapy to standard medical therapy alone, in patients with acute ischemic stroke within 9 hours of stroke onset that are not candidates for thrombolysis and/or thrombectomy. The primary null hypothesis of this trial is that there is no difference in early neurological improvement between RIC plus standard medical therapy and standard medical therapy alone. Study setting: The experimental intervention will be carried out in three Italian Comprehensive Stroke Centers belonging to ISO-associated academic hospitals, represented by ASST Monza-Ospedale San Gerardo di Monza (Università degli Studi di Milano-Bicocca), Azienda Ospedaliera Sant'Andrea (Università degli Studi la Sapienza di Roma), Ospedale di Avezzano (Università degli Studi dell'Aquila). Methods: Experimental Intervention 1. Intervention arm: RIC treatment arm plus standard medical therapy Remote ischemic conditioning will be applied immediately after randomization in the Emergency Department, through a standard blood pressure cuff placed around the non-paretic arm. The protocol includes 4 cycles of intermittent manually induced upper limb ischemia, alternating 5 minutes of inflation (20mmHg above systolic blood pressure) and 5 minutes of deflation. Patients randomized to remote ischemic conditioning will also receive standard medical therapy (see below). 2. Control arm: Standard medical therapy alone Standard medical therapy will be administered immediately after randomization in the Emergency Department. Standard medical therapy comprises single antiplatelet therapy, either aspirin given in a total dose ranging between 100 to 300 mg per day on days 1-5 and followed by aspirin 100mg/day on days 1-5 followed by aspirin 100mg/day, or Clopidogrel 75mg/day (at the discretion of the patient's attending physician), unless an indication for early anticoagulation (e.g. atrial fibrillation, mechanical heart valve, deep venous thrombosis, pulmonary embolism, antiphospholipid antibody syndrome, hypercoagulable state) or dual antiplatelet therapy (e.g. early carotid stenting) is present. All patients will receive standard deep venous thrombosis (DVT) prevention therapy together with appropriate treatment for blood pressure control, glycemic control and cholesterol reduction. Data collection For each eligible patient the following data will be recorded by a designated investigator: * Demographics (age, gender, ethnicity) * Cerebrovascular risk factors (hypertension, diabetes, hyperlipidemia, atrial fibrillation, previous stroke or TIA, ischemic heart disease, peripheral vascular disease) * Past medical/surgical history * Medications prior to randomization (antiplatelets, anticoagulant, antihypertensive, statins) * National Institute of Health Stroke Scale (NIHSS) prior to randomization, at 24h, 48h and 72h * Feasibility (proportion of patients able to terminate RIC) * Wong-Baker faces pain rating scale immediately after RIC and 72h after randomization * CT-head at randomization and within 72h of randomization * Etiology according to TOAST classification at the time of discharge * Disability at 3 months through modified Rankin Scale * Adverse events at 3 months Plasma Biomarkers in acute ischemic stroke patients: Drawing of 7 mL of peripheral venous blood will be performed at 24h and 72h after RIC. * HIF-1α mRNA levels at 24 hours. Total RNA will be extracted from whole blood and transcribed into cDNA. Quantitative reverse transcription polymerase chain reaction (HIF1a F, TCATCCAAG- GAGCCTTAACC; HIF-1a R, AAGCGACATAGTAGGGGCAC) will be performed (Takara Bio, CA, USA). GAPDH will be chosen as the housekeeping gene. * HSP27 plasma levels at 72 hours. Plasma will be obtained by centrifugation and stored at - 20°C. HSP27 (human) will be quantified using a colorimetric enzyme immunoassay (ELISA) kit (Enzo Life Sciences, Roma, Italy). Study duration The investigation will be conducted for an estimated duration of 3 years: * Phase 1. Administrative and ethical procedures: 10 months * Phase 2. Duration of patient enrolment: 18 months. * Phase 3. Follow-up period: 3 months from the date of randomization. * Phase 4. Database lock, statistical analysis and production of a scientific report: 32-36 month. * Planned start of enrolment: upon approval by the Ethics committee and reception of the signed contract. Study design This is a phase II, prospective, block randomized, multicenter, open-label, clinical trial comparing with a 1:1 allocation ratio RIC plus standard medical therapy to standard medical therapy alone, in patients with acute ischemic stroke within 9 hours of stroke onset that are not candidates for thrombolysis and/or thrombectomy. The primary null hypothesis is that there is no or negligible difference in clinical benefit between remote ischemic conditioning plus standard medical therapy and standard medical therapy alone. Sample size An estimated total sample size of 80 patients (40 patients in each arm) should yield 80% power to detect a clinically significant difference of 20% (40% in treatment vs. 20% in control arm) in the median percent change in NIHSS at 72 hours, considering a standard deviation of 30%, at two-sided statistical significance threshold of p = 0.05, when using a Wilcoxon-Mann-Whitney test. Randomization A randomization list stratified by center will be produced using a pseudo-random number generator. The result of the randomization will be delivered after personal data input in a web form. Statistical methods Descriptive analyses will be carried out using classification (number and percentages) in categorical variables and using moments and medians/quartiles in numerical variables. Primary analysis of treatment effect on the early neurological improvement will be analysed using a Wilcoxon-Mann-Whitney test. A secondary analysis on the primary outcome will be performed using a mixed linear regression including treatment and centers and unbalanced important baseline characteristics in case they are present. Feasibility will be measured estimating the proportion of subjects who terminate RIC, together with an exact 95% confidence limit. Description of adverse events will be reported for all randomized subjects. Population examined will be ITT. Cut-off for statistical significance will be set at 0.05, two-tailed.

Interventions

PROCEDURERemote ischemic conditioning

Remote ischemic conditioning will be applied immediately after randomization in the Emergency Department, through a standard blood pressure cuff placed around the non-paretic arm. The protocol includes 4 cycles of intermittent manually induced upper limb ischemia, alternating 5 minutes of inflation (20mmHg above systolic blood pressure) and 5 minutes of deflation.

OTHERstandard medical therapy

Standard medical therapy comprises single antiplatelet therapy, either aspirin given in a total dose ranging between 100 to 300 mg per day on days 1-5 and followed by aspirin 100mg/day on days 1-5 followed by aspirin 100mg/day, or Clopidogrel 75mg/day (at the discretion of the patient's attending physician), unless an indication for early anticoagulation (e.g. atrial fibrillation, mechanical heart valve, deep venous thrombosis, pulmonary embolism, antiphospholipid antibody syndrome, hypercoagulable state) or dual antiplatelet therapy (e.g. early carotid stenting) is present. All patients will receive standard deep venous thrombosis (DVT) prevention therapy together with appropriate treatment for blood pressure control, glycemic control and cholesterol reduction.

Sponsors

San Gerardo Hospital
CollaboratorOTHER
Università degli Studi dell'Aquila
CollaboratorOTHER
University of Roma La Sapienza
CollaboratorOTHER
IRCCS Fondazione Istituto Neurologico Mondino Pavia
CollaboratorUNKNOWN
Istituto Di Ricerche Farmacologiche Mario Negri
CollaboratorOTHER
University of Milano Bicocca
Lead SponsorOTHER

Study design

Allocation
RANDOMIZED
Intervention model
PARALLEL
Primary purpose
TREATMENT
Masking
SINGLE (Outcomes Assessor)

Masking description

Clinicians assessing NIHSS at 24 hours, 48 hours and 72 hours and modified Rankin scale at 3 months will be blinded to treatment allocation.

Intervention model description

Phase II, prospective, multicenter, block randomized, parallel, open-label, clinical trial

Eligibility

Sex/Gender
ALL
Age
18 Years to No maximum
Healthy volunteers
No

Inclusion criteria

* Clinical diagnosis and/or diagnosis on neuromaging of anterior circulation acute ischemic stroke (due to either large or small vessel occlusion) within 9 hours of symptom onset. Information regarding time of stroke onset will be obtained by patient, family member or anyone present at the time of stroke onset or by the emergency medical technician in case the patient is brought to the Emergency Department by the Emergency Medical Services * Age ≥ 18 years * Neurologic deficit with National Institutes of Health Stroke Scale (NIHSS) ≥5 and \<25 * Informed consent obtained from patient whenever possible, or by family member, or legally responsible person in other cases * Stroke with Unknown Time of Onset: the patient either recognized stroke symptoms on awakening or could not report the timing of the onset of symptoms due to neurological deficits (e.g., as a result of aphasia, anarthria, confusion). For patients who recognized stroke symptoms on awakening, onset was estimated as the midpoint of sleep (i.e., the time between going to sleep and waking up with symptoms) and patients underwent randomization if they were within 9 hours of the estimated time of onset. For patients who could not report the timing of symptom onset, the time that had elapsed since the patient was last known to be well had to be \<9 hours. Information regarding time of going to sleep or last time the patient was seen well will be obtained by patient, family member or anyone who had the last contact with the patient before stroke onset. * Modified Rankin Scale≤2 prior to stroke onset

Exclusion criteria

* Patients that are candidates for thrombolysis and/or thrombectomy according to AHA/ASA guidelines * CT Head or brain MRI detecting intracranial hemorrhage, vascular malformation, intracranial masses or any other pathology that could explain symptoms * Rapidly improving neurological symptoms at the time of first evaluation, judged by the attending Physician (Ref: Clotilde Balucani et al. Rapidly Improving Stroke Symptoms: A Pilot, Prospective Study. J Stroke Cerebrovasc Dis, 24 (6), 1211-6 Jun 2015 ) * Transient Ischemic Attack (TIA), with resolution of symptoms at the time of first evaluation * Amputation of the upper non paretic arm * Presence of any ulcer or a bad skin condition in the upper or lower limbs * History of arterial occlusive disease, sickle cell disease (due to the risk of vaso-occlusive crisis), or upper limb phlebitis * Pregnancy * Ongoing participation in any interventional study * Unavailability for follow-up * Advanced or terminal illness, judged by the attending Physician, that could make unlikely patient's availability for follow up at 3 months or life expectancy less than 6 months

Design outcomes

Primary

MeasureTime frameDescription
Efficacy of Remote ischemic conditioning at 72 hours72 hoursEarly neurological improvement at 72 hours, defined as NIHSS percent change (\[Admission NIHSS-72-hour NIHSS\]×100/Admission NIHSS).

Secondary

MeasureTime frameDescription
Efficacy of Remote ischemic conditioning at 48 hours48 hoursEarly neurological improvement at 48 hours, defined as NIHSS percent change (\[Admission NIHSS-48-hour NIHSS\]×100/Admission NIHSS)
Functional status at 90 days90 daysdichotomized functional outcome (0-2 versus 3-5) assessed by modified Rankin Scale at day 90; scale range from 0 (no deficit) to 6 (dead), a higher score means higher disability.
number of paticipants with symptomatic intracerebral hemorrhage36 hourssymptomatic intracerebral hemorrhage per the SITS-MOST definition: a local or remote Type 2 parenchymal hemorrhage on imaging 22 to 36 hours after treatment or earlier if the imaging scan was performed due to clinical deterioration combined with a neurological deterioration of 4 NIHSS points from baseline or from the lowest NIHSS score between baseline and 24 hours or leading to death within 24 hours. A grading of Type 2 parenchymal hemorrhage for intracranial hemorrhage indicates a coagulum exceeding 30% of the infarct with substantial space occupation
Efficacy of Remote ischemic conditioning at 24 hours24 hoursEarly neurological improvement at 24 hours, defined as NIHSS percent change (\[Admission NIHSS-24-hour NIHSS\]×100/Admission NIHSS)
Feasibility of remote ischemic conditioning24 hoursFeasibility will be estimated by the proportion of patients randomized to receive a RIC treatment that complete the treatment, i.e. that complete all 4 cycles (5 minutes each) of intermittent manually induced upper limb ischemia.
Hypoxia-inducible factor 1-alpha mRNA levels24 hours and 72 hoursWhole blood hypoxia-inducible factor 1-alpha mRNA levels expressed ratio to the housekeeping gene GAPDH
Heat shock protein 27 levels24 hours and 72 hoursPlasma heat shock protein 27 levels expressed as ng/mL
Pain related to remote ischemic conditioning72 hoursWong-Baker faces pain rating scale will be administered to patient immediately after RIC and 72 hours after RIC; scale range from 0 to 10, a higher number indicate a higher pain

Countries

Italy

Outcome results

None listed

Source: ClinicalTrials.gov · Data processed: Jul 12, 2026