Are viruses associated with disc degeneration or disc herniation? An evidence of concept study.

Fifteen participants will be recruited prior to undergoing disc herniation surgery in the lumbar spine. Inclusion criteria are: a history of low back pain preceding disc herniation, aged over 18 years, undergoing surgery for removal of disc material. Exclusion criteria are: immuno-compromised, currently ill with an infection. With informed consent we will use sections of vertebral disc fragments removed during surgical interventions from fifteen patients being treated for disc degeneration or herniation. The sterile samples will be immediately stored at 4degreesC for no more than 48 hours, before transport to Murdoch University for storage at minus80degreesC. Following this, samples will be prepared for next generation sequencing for detection of pathogens. For initial total nucleic acid extractions, samples of intervertebral disc material will be homogenised using a mechanical tissue disruption system, followed by extraction of total nucleic acids using a MagMax-96 Viral Isolation Kit (Ambion), according to the manufacturer’s instructions. In order to capture potential RNA and DNA viral species for downstream NGS, total nucleic acid will be converted to dsDNA via a combination of random priming and Klenow fragment based extension and PCR (Ng, Kondov, Deng, Van Eenennaam, & Neilbergs, 2015). Briefly, samples will be subject to reverse transcription using 1 micro L primer NGS1random (CCTTGAAGGCGGACTGTGAGN8) at a concentration of 100 micro M, 7 micro L of purified sample, 10 micro L of Protoscript II buffer (New England BioLabs) and 2 micro L of Protoscript II First Strand cDNA enzyme (New England BioLabs) under the following reaction conditions: 25 degreesC for 5 min, 42degreesC for 60 min and 95degreesC for 3 min. Complementary strand synthesis will be performed by adding 2 micro L of primer NGS1random (10 micro M concentration) and 1 micro L of Klenow polymerase (Promega) and incubating the reaction at 37degreesC for 1 hour. Double-stranded DNA products will then be amplified using primer NGS1 (CCTTGAAGGCGGACTGTGAG) at a final concentration of 1 micro M and AmpliTaq Gold 360 mastermix (Life Technologies) under the following conditions: denaturation at 95degreesC for 5 min, followed by 40 cycles of 95degreesC for 1 min, 55degreesC for 1 min, 72degreesC for 1min (increasing by 5 sec per cycle), and a final extension step of 72degreesC for 10 min. PCR product clean up will be performed using a Wizard SV gel and PCR kit (Promega). Following PCR clean up, each sample will undergo library preparation and individual barcoding using a Nextera XT DNA library preparation kit (Illumina) according to the manufacturer’s instructions. Final libraries will pooled in equimolar amounts, and sequencing performed on an Illumina MiSeq using a V3 2x300 flowcell. Read data will be imported into CLC Genomics Workbench (Qiagen) and demultiplexed. Total reads from each sample will be mapped to the reference human genome to remove host reads, and unmapped reads will be collected for further analysis. Unmapped reads will undergo de novo assembly, and contigs will be searched for homology to viral, bacterial and fungal agents using BLASTn and BLASTx algorithms through the NCBI server (http://blast.ncbi.nlm.nih.gov/Blast.cgi), Diamond (Buchfink, Xie, & Huson, 2015), and One Codex. The participants will complete a brief questionnaire which asks about their age, sex, time since their first ever attack of low back pain. Participants will receive the results of the PCRs at about 1 month after collection. No further follow up will occur by the team after this information is passed on to the surgeon, GP and participant.